2. Welcome to Molecular Biology Through Discovery Tuesday, 15 October 2013 Translation

3. Information + Self-assembly Structure + Function DNA CGACCATCGCCTTAGTACCGACCATCGCCTTAGTAC Protein

4. SQ6: How do you respond to... Alexander Dounce... infinite regress

5. SQ6: How does protein synthesis avoid infinite regress?

7. What ideas underlie this scheme?

8. Alexander Dounce SQ6: How does protein synthesis avoid infinite regress?

9. SQ5: Evidence that proteins are linear? Sanger and Tuppy (1951)

10. SQ6: What are the S-S links mentioned by Crick?

11. Evidence that DNA is linear?

12. SQ6: How does protein synthesis avoid infinite regress? I don't fully understand the different kinds of genetic code. How would the ribosome know what is overlapping and what is not? Mechanism?

13. Types of Codes Study Question 1: Study Question 2: Study Question 3: Study Question 4:... 7 students in class 1456 36 247 34 How to keep track of which student wants what questions?

14. Study Question 1: Study Question 2: Study Question 3: Study Question 4:... 19 students in class 4612 How to keep track of which student wants what questions? 4 6 1 2? Types of Codes

15. Study Question 1: Study Question 2: Study Question 3: Study Question 4:... 19 students in class 4,6,12 How to keep track of which student wants what questions? Variable length code with commas Types of Codes

16. Study Question 1: Study Question 2: Study Question 3: Study Question 4:... 19 students in class 040612 How to keep track of which student wants what questions? Fixed length, 2-digit code Types of Codes

17. Study Question 1: Study Question 2: Study Question 3: Study Question 4:... 200 students in class How to keep track of which student wants what questions? Fixed length, 3-digit code 004106128201 Degenerate or nondegenerate? What kind of code? Types of Codes

18. Length? Degenerate or nondegenerate? What kind of code? Types of Codes SQ18. The Morse Code uses only two symbols (short, long), yet it can specify each of the 26 letters of the English alphabet. How many symbols do you predict must be used to represent one letter?

19. Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUACACUUAGGGCGAU mRNA 64 codons20 amino acids Fixed-length? Variable-length? Degenerate? Non-degenerate? Types of Codes

20. Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... 64 codons20 amino acids Types of Codes

21. Types of Codes Overlapping or not?

30. Possible? SQ23. Consider the codon AGC in an overlapping triplet code. How many possible codons can follow it? If AGC encoded proline, how many amino acids could follow proline?

31. Types of Codes Overlapping or not? How would the ribosome know what is overlapping and what is not?

32. Types of Codes SQ22. How to modify the genetic code so that it is not degenerate? How would the ribosome know what is overlapping and what is not? ACCGUACACUUAGGGCGAU mRNA GUG AAU UGA

33. Types of Codes SQ22. How to modify the genetic code so that it is not degenerate? How would the ribosome know what is overlapping and what is not? ACCGUACACUUAGGGCGAU mRNA GUG UGA Comma-less code

34. Comma-less Code SQ28. If AGA is a legal codon, then what two codons become illegal? Can AAA be part of a comma-less code?

36. ...

38. Me Problem Set 7 #1 Problem Set 7 #5 Problem Set 7 #6 Translation Take your pick

39. Shahroze Mandi Shaun Bobby Supriya Tayab Kaleigh Jonathan Michael Colleen Abdul Cailin Sue Kristen Abdallah Celeste Neda Yordanos Me 1. Sample summaries #1 & #2 2. Problem Set 7 #5 (VA ID) 3. Problem Set 7 #6 (overlap)

41. Central Dogma: DNA to RNA to Protein Replication Processing / Translocation DNA

43. I was wondering what was the distinction between an overlapping and partially overlapping triplet nucleotide codon was SQ22: Interpret T-E-A-T-E-N-D as triplets that are: {overlapping, partially overlapping, non-overlapping}

44. Study Question 11 Degeneracy and frequency of amino acids Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUACACUUAGGGCGAU mRNA 64 codons20 amino acids Fixed-length? Variable-length? Degenerate? Non-degenerate?

45. Study Question 11 Degeneracy and frequency of amino acids Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUACACUUAGGGCGAU mRNA 64 codons20 amino acids GUG

46. Study Question 11 Degeneracy and frequency of amino acids Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUAAACUUAGGGCGAU mRNA 64 codons20 amino acids GUG

47. Study Question 11 Degeneracy and frequency of amino acids Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUAAACUUAGGGCGAU mRNA 64 codons20 amino acids UUG

48. Study Question 11 Degeneracy and frequency of amino acids Codons AAA AAC AAG AAU ACA ACC ACG... UUA UUC UUG UUU Amino acids alanine arginine asparagine aspartate cysteine glutamate glutamine glycine histidine isoleucine leucine... ACCGUAAAUUUAGGGCGAU mRNA UUG 64 codons20 amino acids

49. I was wondering what was the distinction between an overlapping and partially overlapping triplet nucleotide codon was SQ22: Interpret T-E-A-T-E-N-D as triplets that are: {overlapping, partially overlapping, non-overlapping}