1. Author(s): David Ginsburg, 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution–Non-commercial–Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/ We have reviewed this material in accordance with U.S. Copyright Law and have tried to maximize your ability to use, share, and adapt it. The citation key on the following slide provides information about how you may share and adapt this material. Copyright holders of content included in this material should contact open.michigan@umich.edu with any questions, corrections, or clarification regarding the use of content. For more information about how to cite these materials visit http://open.umich.edu/education/about/terms-of-use. Any medical information in this material is intended to inform and educate and is not a tool for self-diagnosis or a replacement for medical evaluation, advice, diagnosis or treatment by a healthcare professional. Please speak to your physician if you have questions about your medical condition. Viewer discretion is advised: Some medical content is graphic and may not be suitable for all viewers.

2. Citation Key for more information see: http://open.umich.edu/wiki/CitationPolicy Use + Share + Adapt Make Your Own Assessment Creative Commons – Attribution License Creative Commons – Attribution Share Alike License Creative Commons – Attribution Noncommercial License Creative Commons – Attribution Noncommercial Share Alike License GNU – Free Documentation License Creative Commons – Zero Waiver Public Domain – Ineligible: Works that are ineligible for copyright protection in the U.S. (USC 17 § 102(b)) *laws in your jurisdiction may differ Public Domain – Expired: Works that are no longer protected due to an expired copyright term. Public Domain – Government: Works that are produced by the U.S. Government. (USC 17 § 105) Public Domain – Self Dedicated: Works that a copyright holder has dedicated to the public domain. Fair Use: Use of works that is determined to be Fair consistent with the U.S. Copyright Act. (USC 17 § 107) *laws in your jurisdiction may differ Our determination DOES NOT mean that all uses of this 3rd-party content are Fair Uses and we DO NOT guarantee that your use of the content is Fair. To use this content you should do your own independent analysis to determine whether or not your use will be Fair. { Content the copyright holder, author, or law permits you to use, share and adapt. } { Content Open.Michigan believes can be used, shared, and adapted because it is ineligible for copyright. } { Content Open.Michigan has used under a Fair Use determination. }

3. DNA Sequence Variation David Ginsburg, MD August 13, 2008 M1 Patients and Populations Fall 2008

4. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

5. Chromosomes, DNA, and Genes Proteins \ Jfdwolff (wikimedia)Jfdwolff (wikimedia Wikimedia Commons

6. TRANSCRIPTION Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E; Figure 5.1

7. 1944 DNA is the genetic material 1949 Abnl Hemoglobin in sickle cell anemia 1953 Double helix 1956 Glu 6 Val in sickle hemoglobin 1966 Completion of the genetic code 1970 First restriction enzyme 1972 Recombinant plasmids 1975 Southern blotting 1981 Transgenic mice 1983 Huntington Disease gene mapped 1985 PCR 1986 Positional cloning (CGD, muscular dystrophy, retinoblastoma 1945 19501955 1960 1965 1970 19751980 19851990 1995 2000 1987 Knockout mice 1989 Positional cloning without deletion (CF) 1990 First NIH- approved gene therapy experiment 1996 Complete yeast genome sequence 1995 1 st complete bacterial genome sequence 2001 Draft human genome sequence Since 2001: Complete human genome complete; human hapmap; Other genomes: mouse, rat, dog, chimp, chicken, zebrafish…18 vertebrates, 8 invertebrates, >500 microbial genomes. Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E; Figure 5.4

8. DNA Samples and PCR Blood sample DNA for analysis cheek swab urine sample Forensic specimens DNA Repeat cycles Amplified product Target sequence primers Source: Dennis Myts (wikimedia) D. Ginsburg

9. Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E; Figure 5.8

10. Hybridization array: gene chip DNA chip v6.0: ~1 million SNPs RNA expression: All ~ 20,000 genes CGH: Survey whole genome for large deletions, insertions, rearrangements Ricardipus (wikipedia)wikipedia

11. Image of DNA sequencing process removed

12. DNA Sequencing Source Undetermined

13. New Sequencing Technologies Source Undetermined

14. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

15. DNA Sequence Variation DNA Sequence Variation: –Human to human: ~0.1% (1:1000 bp) Human genome = 3X10 9 bp X 0.1% =~3X10 6 DNA common variants –Human to chimp: ~1-2% –More common in “junk” DNA: introns, intergenic regions poly·mor·phism Pronunciation: "päl-i-'mor-"fiz-&m Function: noun : the quality or state of existing in or assuming different forms: as a (1) : existence of a species in several forms independent of the variations of sex (2) : existence of a gene in several allelic forms (3) : existence of a molecule (as an enzyme) in several forms in a single species

16. Mutations A mutation is a change in the “normal” base pair sequence Can be: –a single base pair substitution –a deletion or insertions of 1 or more base pairs (indel) –a larger deletion/insertion or rearrangement Dennis Myts (wikimedia)

17. Polymorphisms and Mutations Genetic polymorphism: –Common variation in the population: Phenotype (eye color, height, etc) genotype (DNA sequence polymorphism) –Minor allele frequency > 1% DNA (and amino acid) sequence variation: –Most common allele < 0.99 = polymorphism (minor allele > 1%) –Variant alleles < 0.01 = rare variant Mutation-- any change in DNA sequence –Silent vs. amino acid substitution vs. other –neutral vs. disease-causing Common but incorrect usage: –“mutation vs. polymorphism” balanced polymorphism= disease + polymorphism

18. Common but incorrect usage: “a disease-causing mutation” OR “a polymorphism” All DNA sequence variation arises via mutation of an ancestral sequence “Normal” “Disease” < 1%> 1% Rare variant or “private” polymorphism Disease mutation Example: Factor V Leiden (thrombosis) 5% allele frequency

19. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

20. Types of DNA Sequence Variation RFLP: Restriction Fragment Length Polymorphism VNTR: Variable Number of Tandem Repeats –or minisatellite –~10-100 bp core unit SSR : Simple Sequence Repeat –or STR (simple tandem repeat) –or microsatellite –~1-5 bp core unit SNP: Single Nucleotide Polymorphism –Commonly used to also include rare variants Insertions or deletions –INDEL – small (few nucleotides) insertion or deletion Rearrangement (inversion, duplication, complex rearrangement) CNV: Copy Number Variation

21. VNTR Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E; Figure 5.19

22. STR Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E; Figure 5.22

23. SNP Most are “silent” Intragenic Promoters and other regulatory sequences Introns Exons –5’ and 3’ untranslated regions –Coding sequence (~1-2% of genome) Allele 1 AUGAAGUUUGGCGCAUUGAAC Allele 2 AUGAAGUUUGGUGCAUUGAAC Adapted from ASCO teaching slides

24. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

25. Silent Sequence Variants (Synonymous SNP) Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A A Gln C Sequence variant mRNAProtein A UG Met A A G Lys UU U Phe G G U Gly G C A Ala U U G Leu A A Gln C G Changes that do not alter the encoded amino acid Adapted from ASCO teaching slides

26. Missense Mutations Missense Missense: changes to a codon for another amino acid (can be harmful mutation or neutral variant ) (nonsynonymous SNP) mRNAProtein Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A UG Met A A G Lys UU U Phe A G C Ser G C A Ala U U G Leu A A Gln CA A C Adapted from ASCO teaching slides

27. Nonsense: change from an amino acid codon to a stop codon, producing a shortened protein (nonsynonymous SNP) Nonsense mRNAProtein Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A UG Met U A GUU U G G C G C AU U G A A Gln CA A C Nonsense Mutations STOP Adapted from ASCO teaching slides

28. Frameshift U GC A A A UG Met A A G Lys G C G Ala C AU UU U G Leu Frameshift: insertion or deletion of base pairs, producing a stop codon downstream and (usually) shortened protein mRNAProtein Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A A Gln C Frameshift Mutations STOP Adapted from ASCO teaching slides

29. Exon 1 Intron Exon 2 Intron Exon 3 Exon 1 Exon 3 Altered mRNA Splice-site mutation: a change that results in altered RNA sequence Exon 2 Splice-site Mutations Adapted from ASCO teaching slides

30. Other Types of Mutations Mutations in regulatory regions of the gene Mutations in regulatory regions of the gene Large deletions or insertions Large deletions or insertions Chromosomal translocations or inversions Chromosomal translocations or inversions

31. Copy Number Variation (CNV) Kb to Mb in size (average ~250 Kb) >>2000 known, affect ~12% of human genome ? ~100 / person ? Role in human disease/normal traits Nature 444:444, Nov 2006.

32. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

33. Tests to Detect Mutations Many methods/technologies Rapidly changing DNA sequencing –Most direct and informative –The gold standard –Targeted region (known mutation) –“Whole” gene (unknown mutation) –… Whole genome

34. How do we distinguish a disease causing mutation from a silent sequence variation? Obvious disruption of gene –large deletion or rearrangement –frameshift –nonsense mutation Functional analysis of gene product –expression of recombinant protein –transgenic mice New mutation by phenotype and genotype Computer predictions Disease-specific mutation databases –Same/similar mutation in other patients, not in controls Rare disease-causing mutation vs. private “polymorphism” (rare variant) X

35. Understand the meaning of DNA sequence and amino acid polymorphisms. Recognize the different types of DNA sequence polymorphisms: – RFLP, VNTR, STR, SNP, CNV Know the different classes of DNA mutation: –Point mutations (silent, missense, nonsense, frameshift, splicing, regulatory) insertion/deletions, rearrangements Understand how to distinguish a disease-causing mutation from a neutral DNA sequence variation Learning Objectives

36. Slide 5: Jfdwolff (wikimedia) http://creativecommons.org/licenses/by-sa/3.0/; http://commons.wikimedia.org/wiki/File:Chromosome_zh-tw.svghttp://creativecommons.org/licenses/by-sa/3.0/ http://commons.wikimedia.org/wiki/File:Chromosome_zh-tw.svg Slide 6: Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E, Figure 5.1 Slide 7: Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E, Figure 5.4 Slide 8: D. Ginsburg Slide 9: Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E, Figure 5.8 Slide 10: CC: BY-SA: Ricardipus (wikipedia) http://creativecommons.org/licenses/by-sa/2.0/deed.enhttp://creativecommons.org/licenses/by-sa/2.0/deed.en Slide 11: Image of DNA sequencing process removed Slide 12: Undetermined Slide 13: Undertirmined Slide 16: Dennis Myts (wikimedia) Slide 21: Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E, Figure 5.19 Slide 22: Gelehrter, Collins and Ginsburg: Principles of Medical Genetics 2E, Figure 5.22 Slide 23: Adapted from ASCO teaching slides Slide 25: Adapted from ASCO teaching slides Slide 26: Adapted from ASCO teaching slides Slide 27: Adapted from ASCO teaching slides Slide 28: Adapted from ASCO teaching slides Slide 29: Adapted from ASCO teaching slides Slide 31: Nature 444:444, Nov 2006. Additional Source Information for more information see: http://open.umich.edu/wiki/CitationPolicy