2. Chapter 12 Text book Notes

3. 12-1 TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) How did we find out that this happens…?

4. 1928 Griffith: British scientist Prob? How do bacteria make people sick? –Specifically the bacteria pneumonia… Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B) Results : (what do you think will happen- which bcateria will kill the mice?)

5. Harmless bacteria? Mice lived Bacteria AMice dies Flamed Bacteria A Mice livedWhy? Flamed Bacteria A and Bacteria B Mice died Why? The good bacteria picked up the DNA, from the dead disease causing bacteria, and it became disease causing too

6. 12-3 RNA & Protein Synthesis Synthesis? –DNA instruction is in code ATCCGGTTAAAGGTCCCTCTCTGATCC CGTATTAAAGTCGATTGACGATGCAGT GACGATGAAGTCGAAAACCGGTTGTG TGCCAGTGGCAGTGATG –Code controls the making of proteins (which control traits: ex blood type, flower color ) –QUESTION OF THE DAY: How can we decode that message?

7. Decode Message Message needs to go from nucleus to ribosomes….

8. DNA vs RNA DNA- deoxy, ribo, nucleic, acid RNA – ribo, nucleic, acid Double strandSingle strand Deoxyribose (sugar)Ribose (sugar) Nitogen Bases: ATCGNitrogen Bases: AUCG JOB- instructions for all cellsJOB: protein synthesis (needed by body for growth and repair)

9. Meet the RNA family … mRNA travels to ribosomes rRNA is present at the ribosomes tRNA- transfers the amino acids to the ribosomes

10. Transcription Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand Step 2: mRNA looks only for the section that it needs to copy Step 3: mRNA finds the section and copies it but in its own complementary language Step 4: mRNA goes to Ribosome with message

11. Translation Step 1: mRNA arrives at the ribosome, and rRNA is already there waiting…. Step 2: mRNA and rRNA show the section of the code in codons in (mRNA language) to all the present tRNA’s Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid. Step 4: After a bunch of amino acids line up- proteins are made….

15. http://www.youtube.com/watch?v=983lhh2 0rGYhttp://www.youtube.com/watch?v=983lhh2 0rGY Video transcription and translation Video replication http://www.youtube.com/watch?v=hfZ8o9 D1tus&feature=relatedhttp://www.youtube.com/watch?v=hfZ8o9 D1tus&feature=related

16. 12-4 Mutations: change in the genetic material …. Now and again cells make mistakes in copying DNA

17. 2 types of Mutations Gene mutations Chromosomal mutations

18. Gene Mutations Occur on a single gene TAC GCA TGG AAT Code is read in 3 base codons Thefatcatandratran- say?

19. 3 types of gene mutations Point Mutations occur at 1 spot TAC GCA TGG AAT – original Substitution? Insertion? Deletion ?

20. TAC GCA TGG AAT – original Substitution – TAC GGA TGG AAT Insertion –TAC GGC ATG GAA T Deletion –TAC GAT GGA AT

21. Which are the 2 worst kinds of point mutations? Why? THE FAT CAT RAN – original Substitution – THH FAT CAT RAN Insertion –THE FAA TCA TRA N Deletion –HEF ATC ATR AN

22. Which are the 2 worst kinds of point mutations? Why? Changes message which changes the amino acid that is made- wrong protein made …

23. Chromosomal Mutations Changes in the … –Number of chromosomes Down’s Syndrome –Or structure of chromosome Deletion Duplication Inversion Translocation

24. See chrom. Mut. Chart http://www.pearsonsuccessnet.com/snpap p/iText/products/0-13-181118- 5/ch12/sb7015a04.htmlhttp://www.pearsonsuccessnet.com/snpap p/iText/products/0-13-181118- 5/ch12/sb7015a04.html

25. Deletion- 1 section is deleted Duplication- 1 section is doubled Inversion- 1 section is reversed Translocation -part of one chromosome breaks off and attaches to another.

26. Mutations are good, bad or neutral Neutral Bad: cause dramatic changes in protein structure… body cannot function properly Good.. Can create variability in species, can be beneficial, if environment –Ex- AIDS resistant gene –Polyploidy (extra chromosomes) Banana and citrus fruits are larger and stronger