Download presentation
Presentation is loading. Please wait.
Published byEthan Stephens Modified over 8 years ago
1
Who knows the code? - Take one Who knows the code? - Take one What happens if a tRNA carries the wrong amino acid? What happens if a tRNA carries the wrong amino acid? What happens if the mRNA contains a copy error relative to DNA? What happens if the mRNA contains a copy error relative to DNA? What happens if a tRNA has a mutated anticodon What happens if a tRNA has a mutated anticodon
2
Choreographing translation A play of many parts, many players A play of many parts, many players Let us do this quickly! But a reminder… Let us do this quickly! But a reminder…
3
Roles 4 tRNA (1-2 people) 4 tRNA (1-2 people) 4 teams to be synthetases (1-2 people) 4 teams to be synthetases (1-2 people) 1 group to be the ribosome (~3 people) 1 group to be the ribosome (~3 people) 1 group to be (RNA polymerase + mRNA) (~3 peeps) 1 group to be (RNA polymerase + mRNA) (~3 peeps) 1 termination factor (1-2 people) 1 termination factor (1-2 people)
4
Learning your ‘lines’ Handout: Each group find the questions related to their role and answer them Handout: Each group find the questions related to their role and answer them Lab manual, textbook, internet OK as sources Lab manual, textbook, internet OK as sources Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts… Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts…
5
DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’
6
DNA template strand (alternate version) 5’ CTTAAATCCGAATGCCCATG 3’
7
Special powers Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can inspect ALL of the mRNA and help ribosome to assemble Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can inspect ALL of the mRNA and help ribosome to assemble
8
Going with the flow mRNA at the central bench mRNA at the central bench ribosome assembles around it ribosome assembles around it synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) tRNAs will ‘diffuse’ by following a path through the room tRNAs will ‘diffuse’ by following a path through the room When any event first happens*, action stops, molecules involved will announce, explain When any event first happens*, action stops, molecules involved will announce, explain Go until a protein happens Go until a protein happens *This includes non-events (rejections, etc.)
9
Who knows the code? What happens if a tRNA carries the wrong amino acid? What happens if a tRNA carries the wrong amino acid? What happens if the mRNA contains a copy error relative to DNA? What happens if the mRNA contains a copy error relative to DNA? What happens if a tRNA has a mutated anticodon What happens if a tRNA has a mutated anticodon
10
First some lovely terminology - Nucleic Acids Monomer : nucleotides (pentose sugar + phosphate + purine/pyrimidine base) Monomer : nucleotides (pentose sugar + phosphate + purine/pyrimidine base)
11
Nucleic Acids Primary Biological Function : information storage Primary Biological Function : information storage cellbio.utmb.edu/cellbio/ribosome.htm
12
Proteins Amino acids are linked together by peptide bonds to form one or more macromolecule subunits called polypeptides. Long chains of polypeptides result in the formation of proteins. The primary amimo acid sequence of a protein determines its secondary, tertiary, and quaternary structure, which then in turn determines its functional state. Amino acids are linked together by peptide bonds to form one or more macromolecule subunits called polypeptides. Long chains of polypeptides result in the formation of proteins. The primary amimo acid sequence of a protein determines its secondary, tertiary, and quaternary structure, which then in turn determines its functional state.
13
Or yet to say it another way It’s important to note that each amino acid in the chain can be thought of having certain gross chemical features. For example, these may be hydrophobic, hydrophilic, or electrically charged. It’s important to note that each amino acid in the chain can be thought of having certain gross chemical features. For example, these may be hydrophobic, hydrophilic, or electrically charged. These variables interact with each other and their surroundings in the cell to produce a well- defined, three dimensional shape. These variables interact with each other and their surroundings in the cell to produce a well- defined, three dimensional shape. The native state of a protein refers to it’s functional or operative form. The native state of a protein refers to it’s functional or operative form.
14
Proteins Monomer : AMINO ACIDS Monomer : AMINO ACIDS Covalent Bond : PEPTIDE BOND Covalent Bond : PEPTIDE BOND
15
Proteins Primary Biological Functions : NUMEROUS INTRACELLULAR ROLES; CATALYSIS (speeding up chemical reactions) Primary Biological Functions : NUMEROUS INTRACELLULAR ROLES; CATALYSIS (speeding up chemical reactions)
16
Proteins Key Examples : enzymes (catalysts); membrane transporters (bind and allow passage of certain molecules into cells); signaling proteins Key Examples : enzymes (catalysts); membrane transporters (bind and allow passage of certain molecules into cells); signaling proteins
17
You should know… Protein folding, oil not mixing with water, and membrane formation all reflect the same principle Protein folding, oil not mixing with water, and membrane formation all reflect the same principle In protein folding, the constraint is that the individual units are all attached to a pair of neighbors In protein folding, the constraint is that the individual units are all attached to a pair of neighbors Many proteins need no further ‘instruction’ than their sequence & water to correctly assume their superhero identity Many proteins need no further ‘instruction’ than their sequence & water to correctly assume their superhero identity
18
Proteins & structure Essential biology, 2nd ed.
19
Proteins Proteins denatured by heat, alterations in pH, or certain chemicals lose tertiary and secondary structure. Proteins denatured by heat, alterations in pH, or certain chemicals lose tertiary and secondary structure.
20
Proteins Oxygen reversibly bound to hemoglobin in red blood cells Each molecule of hemoglobin can carry a maximum of four molecules of O2
21
Helix, Sheet, Thinking
22
Protein folding images in 3D
23
Proteins Affinity of hemoglobin for O2 depends on PO2 to which hemoglobin is exposed hemoglobin picks up O2 as it flows through respiratory exchange structures and gives up O2 in metabolically active tissues The affinity of hemoglobin for O2 is decreased by the presence of hydrogen ions or metabolites of glycolysis
24
Proteins Myoglobin has a high affinity for O2 and serves as an O2 reserve in muscle Fetal hemoglobin has a higher affinity for O2 than does maternal hemoglobin, allowing fetal blood to pick up O2 from the maternal blood in the placenta
25
Proteins www.defiers.com/scd.html Sickle cell anemia = 2 hydrophobic spots (one arising via mutation) get stuck together in presence of water New sticky spots make hemoglobins form GIANT chains; these deform RBC, reduce their flexibility, and cause them to get trashed in tiny vessels, loss of too many RBC => not enough O2 transport = anemia. Bad news!!!
26
Seventy Great Mysteries of the Natural World Thames & Hudson p. 112
27
The real structure – Beautiful !
28
Hemoglobin tutorial Read the instructions on the intro... Read the instructions on the intro... Read the instructions on each question... Read the instructions on each question... Read the instructions on the webpage... Read the instructions on the webpage... Read all the words of each question... Read all the words of each question...... or gnash your teeth in frustration & futility!... or gnash your teeth in frustration & futility!
29
Different tools; different jobs Your group has an amino acid; which is it? Your group has an amino acid; which is it? In what ways are all bases identical? Different? In what ways are all bases identical? Different? In what ways are all amino acids identical? Different? In what ways are all amino acids identical? Different? Which group is more diverse in terms of ‘feel’? Which group is more diverse in terms of ‘feel’? Which is more diverse in terms of shape? Which is more diverse in terms of shape? Which would allow you to build more diverse shapes & surfaces? Which would allow you to build more diverse shapes & surfaces?
30
Homework for next week Assessor: “Chimeric Dictyostelium Paper” Assessor: “Chimeric Dictyostelium Paper” Same deal as before – find the paper and read (or scan) it. Do the assignment before next class. Same deal as before – find the paper and read (or scan) it. Do the assignment before next class.
31
More paper fun! Introduction to the scientific literature Introduction to the scientific literature It really is important that you know how to navigate one of these things, besides – it’s probably one of the easier Assessor type assignments! (if there is possibly such a thing) It really is important that you know how to navigate one of these things, besides – it’s probably one of the easier Assessor type assignments! (if there is possibly such a thing)
32
Why read ? Rather than always reproducing everything ever done, past work is filtered and ‘accepted’ Rather than always reproducing everything ever done, past work is filtered and ‘accepted’ Accessing this body of knowledge can be a source of inspiration, insight, inquisitiveness Accessing this body of knowledge can be a source of inspiration, insight, inquisitiveness buyer beware: both the writing and the reviewing of papers is done by real people with the requisite strengths & weaknesses buyer beware: both the writing and the reviewing of papers is done by real people with the requisite strengths & weaknesses
33
For 181 Lab A paper about an organism that you will be experimenting with A paper about an organism that you will be experimenting with An introduction to the biology and study of the organism An introduction to the biology and study of the organism A homework assignment requiring you to read, understand A homework assignment requiring you to read, understand
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.