1. Transcription, Translation & Protein Synthesis

2. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm.

3. Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

4. Ribonucleic Acids (RNA) There are three types of RNA: 1. mRNA – carries a message from the DNA to the ribosome 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.

5. Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: 1. RNAsugar ribose 1. RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

6. Ribonucleic Acids (RNA)

7. Protein Synthesis Occurs in TWO steps: 1. Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein)

8. The Central Dogma This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N

9. Step One: Transcription 1. DNA unzips 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different?? 3. New backbone formed: What will be different??

10. Step One: Transcription Watch this simplified animation: Transcription animation

11. Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

12. Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

13. Step 1½: RNA Editing An mRNA molecule has to be “ edited ” because there ’ s a lot of unnecessary information that needs to be removed. intron An mRNA sequence that does NOT code for protein is called an intron. exon A sequence that is useful in making a protein is called an exon.

14. Step 1½: RNA Editing DNA exon 1 interon exon 2 interon exon 3 pre-RNA (in nucleus) exon 1exon 2exon 3 RNA (in cytoplasm) transcription interon RNA editing

15. Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mRNA sequence into codons. 3. Codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

16. 3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG)

17. Step Two: Translation Watch this simplified animation: Translation Animation

18. Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. pheilevalproalahisasnaspcysarg leumetserthrtyrglnlysglutrpgly A T C G

19. Step Two: Translation 2. You need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

20. tRNA A go-getter. Gets the right amino acids to make the right protein according to mRNA instructions It contains anti-codons EX: UAC – mRNA AUG – tRNA

21. Transfer RNA (tRNA) Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

22. The Genetic Code

23. Step Two: Translation 2. Since each 3-letter combination “ codes ” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

24. The Genetic Code

25. Step Two: Translation 2. Since each 3-letter combination “ codes ” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser

26. Step Two: Translation 2. Since each 3-letter combination “ codes ” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser

27. RECAP: 1. DNA is transcribed into mRNA in the nucleus. 2. The mRNA leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mRNA sequence using tRNA and amino acids.