Presentation is loading. Please wait.

Presentation is loading. Please wait.

Relate the concept of the gene to the sequence of nucleotides in DNA.

Published byHarry Conley Modified over 9 years ago

Similar presentations

Presentation on theme: "Relate the concept of the gene to the sequence of nucleotides in DNA."— Presentation transcript:

1 Relate the concept of the gene to the sequence of nucleotides in DNA.
CH : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis

2 Genes and Proteins The sequence of nucleotides in DNA contain information. This information is put to work through the production of proteins. Proteins fold into complex, three dimensional shapes to become key cell structures and regulators of cell functions. Thus, by encoding the instructions for making proteins, DNA controls cells.

3 Genes and Proteins You learned earlier that proteins are polymers of amino acids. The sequence of nucleotides in each gene contains information for assembling the string of amino acids that make up a single protein.

4 DNA  Proteins  Cells  Bodies
DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

5 Cell organization DNA DNA is in the nucleus
genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

6 Cell organization Proteins chains of amino acids
made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

7 Passing on DNA information: need RNA
RNA like DNA, is a nucleic acid RNA structure differs from DNA structure in three ways. 1. Has ribose sugar instead of deoxyribose (DNA) 2. Replaces thymine (T) with uracil (U) 3. Single stranded as opposed to double stranded DNA Nitrogenous base (A, G, C, or U) Phosphate group Uracil (U) Sugar (ribose)

8 RNA RNA has a different function than DNA
Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. RNAs take from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNAs assemble the protein.

9 RNA 3 types of RNA 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis. 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins binds (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time

10 Passing on DNA information
Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

11 Protein Synthesis: 2 step process 1. Transcription 2. translation
1.Transcription: DNA -> mRNA In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein

12 From nucleus to cytoplasm
transcription DNA mRNA protein translation trait nucleus cytoplasm

13 Transcription Making mRNA from DNA
DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

14 Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

15 Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

16 Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

17 Matching bases of DNA & RNA
U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

18 RNA Processing Not all the nucleotides in the DNA of eukaryotic cells carry instructions—or code—for making proteins. Genes usually contain many long noncoding nucleotide sequences, called introns, that are scattered among the coding sequences. Regions that contain information are called exons because they are expressed. When mRNA is transcribed from DNA, both introns and exons are copied. The introns must be removed from the mRNA before it can function to make a protein. Enzymes in the nucleus cut out the intron segments and paste the mRNA back together. The mRNA then leaves the nucleus and travels to the ribosome.

19 RNA Processing:simplified
Noncoding segments called introns are spliced out ( coding segment = exons)

20 Genetic information written in codons is translated into amino acid sequences
Transfer of DNA to mRNA uses “language” of nucleotides Letters: nitrogen bases of nucleotides (A,T,G,C) Words: codons ~triplets of bases ( ex. AGC) Sentences: polypeptide chain The codons in a gene specify the amino acid sequence of a polypeptide

21 The Genetic Code The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. Virtually all organisms share the same genetic code

22 Translation: From mRNA to Protein
takes place at the ribosomes in the cytoplasm. Involves 3 types of RNA 1. Messenger RNA (mRNA) =carries the blueprint for construction of a protein 2. Ribosomal RNA (rRNA) = the construction site where the protein is made 3. Transfer RNA (tRNA) = the truck delivering the proper amino acid to the site at the right time

23 Transfer RNA molecules serve as interpreters during translation
In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide The process is aided by transfer RNAs Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other Anticodon base pairs with codon of mRNA

24 cytoplasm protein nucleus ribosome U C A G trait

25 How does mRNA code for proteins
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

26 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

27 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

28 The Genetic code For ALL life! Code has duplicates Start codon
strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

29 How are the codons matched to amino acids?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

30 mRNA to protein = Translation
The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

31 From gene to protein DNA mRNA protein trait tRNA transcription
aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

32 cytoplasm protein transcription translation nucleus trait

33 From gene to protein protein transcription translation

Download ppt "Relate the concept of the gene to the sequence of nucleotides in DNA."

Similar presentations

From Gene to Protein How Genes Work

From Gene to Protein How Genes Work
CH 11.4 & 11.5 “DNA to Polypeptide”.

CH 11.4 & 11.5 “DNA to Polypeptide”.
Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.

Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.
RNA and Protein Synthesis

RNA and Protein Synthesis
Protein Synthesis Making Proteins

Protein Synthesis Making Proteins
Replication, Transcription, & Translation

Replication, Transcription, & Translation
Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.
DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.

DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.
Bell Work What four enzymes are used in DNA replication? Name them in the order the appear.

Bell Work What four enzymes are used in DNA replication? Name them in the order the appear.
10-2: RNA and 10-3: Protein Synthesis

10-2: RNA and 10-3: Protein Synthesis
Regents Biology 2009-2010 Protein Synthesis Making Proteins.

Regents Biology Protein Synthesis Making Proteins.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
8.4 DNA Transcription 8.5 Translation

8.4 DNA Transcription 8.5 Translation
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
11.2. Remember…. Nucleic Acid – one of the BIG FOUR DNA – Deoxyribonucleic Acid Directions for building proteins Nucleotides are building blocks Sugar-

11.2. Remember…. Nucleic Acid – one of the BIG FOUR DNA – Deoxyribonucleic Acid Directions for building proteins Nucleotides are building blocks Sugar-
Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.
Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.

Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.
Protein Synthesis. DNA acts like an instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
VII RNA and Protein Synthesis

VII RNA and Protein Synthesis
RNA & Protein Synthesis. DNA Determines Protein Structure The genetic information that is held in the molecules of DNA ultimately determines an organism’s.

RNA & Protein Synthesis. DNA Determines Protein Structure The genetic information that is held in the molecules of DNA ultimately determines an organism’s.

Similar presentations

Ads by Google