2. Do Now  1. What is RNA?  2. What are proteins used for in our bodies?

3. DNA Transcription and Translation Sections 12.3 and 12.4

4. Gene  Segment of DNA that codes for a protein  The Central Dogma of Biology:  DNA codes for RNA and RNA makes protein (the synthesis of) DNARNAProtein

5. Beadle and Tatum Experiment  Experiments on mold, Neurospora, were the first to demonstrate the relationship between genes and enzymes.  Studied mold spores that were mutated by exposure to X-rays and grown on a complete medium  Minimal Medium- no amino acids provided  Complete Medium- all amino acids provided.  (normally Neurospora can grow on both)

6. Beadle and Tatum Continued  Grew spores exposed to X-rays on minimal medium. When there was no growth, the mutant was tested to see what amino acid it lacked.  When the mutant grew on the minimal medium with arginine (amino acid), the mutant was missing the enzyme needed to make arginine.

8. One Gene-One Enzyme Beadle and Tatum’s Hypothesis:  One Gene- One Enzyme.  One gene codes for one polypeptide.  polypeptide - a chain of covalently bonded amino acids.  (proteins are made of one or more polypeptide)

9. Let’s make some observations about RNA’s structure

10. RNA  RNA stands for:  Ribonucleic acid  RNA is found:  Nucleus and Cytoplasm

11. RNA Structure  Like DNA, RNA is made up of subunits called _____________, which are made of three parts:  Sugar (ribose)  Phosphate  Nitrogen Base

12. RNA’s Nitrogen Bases  Adenine (A)  Cytosine (C)  Guanine (G)  Uracil (U)

13. There are 3 types of RNA: 1. Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA. 1. Carries genetic information from DNA in the nucleus to Ribosome in the cytoplasm.

14. Types of RNA: 2. Ribosomal RNA (rRNA) – associates with protein to form the ribosome.

15. Types of RNA: 3. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.

16. All RNA is …  Single stranded  Many different shapes  “Cheap copy” of DNA

17. Fill in chart below: DNARNA Structure Sugar Base Example strand: Complimentary: TACGA

18. Do Now Fill in the Venn Diagram below:  What are the three types of RNA? What is the purpose of each? DNA RNA Both

19. Transcription  First step in making proteins  Process of taking one gene (DNA) and converting into a mRNA strand  Location:  Nucleus of the cell DNAmRNA

20. Steps to Transcription  1. An enzyme (RNA polymerase) attaches to the promoter (start signal region) of a gene and unwinds the DNA

21. Steps to Transcription (Cont.)  2. One strand acts as a template.

22. Steps to Transcription (Cont.)  3. A mRNA copy is made from the DNA template strand by RNA polymerase  4. mRNA is made until it reaches the termination (stop signal) sequence  5. mRNA is released, and the two strands of DNA rejoin.

24. Template vs. Non Template Strand

26. Transcription animation  https://www.youtube.com/watch?v=ztPkv7wc3yU https://www.youtube.com/watch?v=ztPkv7wc3yU

27. Transcribe this DNA to mRNA

28. Do Now  Label the Transcription diagram

29. mRNA Processing  Pre-mRNA – the original sequence of RNA created during transcription  mRNA reaches the ribosomes

30. RNA Processing In Eukaryotes only  Introns- non-coded sections (a.k.a “Junk” DNA)  Exons- codes for a protein Before RNA leaves the nucleus, introns are removed and exons are spliced together  A 5’cap and poly A tail are added to ends of the sequence  mRNA leaves the nucleus through the nuclear pores

32. Why is it necessary to add the poly A tail and 5’ cap? Keeps mRNA from degradation, and helps mRNA bind to ribosome.

33. RNA Processing

34. Let’s try this example…  Original DNA Sequence (DNA):  5’ GTACTACATGCTATGCAT 3’  Translate it (RNA):  3’ CAUGAUGUACGAUACGUA 5’  Add the 5’ cap:  3’ CAUGAUGUACGAUACGUA 5’ cap

35. Finish the job!  Remove the introns “UGUA” and “AUAC”: 3’ CAUGAUGUACGAUACGUA 5’ cap 3’ CAUGACGGUA 5’ cap Add a poly A tail onto the 3’ end 3’ CAUGACGGUA 5’ cap Poly A tail

36. Think, Pair, Share  Take a minute think on your own, then pair with your partner, and share your ideas!  Evolutionary, why do you think there are introns?  Where did they come from? Remember there is NO wrong answer!

37. Do Now  Perform transcription on this DNA segment: GCTTCATACGA  Do RNA processing and remove the introns: GAA and UGC

38. Proteins are made up of amino acids!!!  Proteins are polymers of amino acids  Only 20 different amino acids  BUT there are hundreds of thousands of different proteins How can this be?

39. Let’s compare to it to the English language How many letters are in the alphabet? A,b,c,d,… 26 How many words are there? Miss, P, is, smart,.. Almost infinite! Each word has a unique structure of letters. Similar to proteins and amino acids

40. Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains

41. How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins created by dehydration synthesis!

42. How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids?

43. Pg. 339  Pg. 339

44. Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

45. Translation  Production of proteins from mRNA  mRNA goes to the ribosomes in the cytoplasm or the RoughER and produces proteins  Three main stages:  Initation  Elongation  Termination

46. Ribosome  Two subunits to the ribosome  Large subunit, and small subunit  3 sites (grooves) on the ribosome (A, P, E )  A: tRNA binding site  P: polypeptite bonding site  E: exit site

47. Steps to Translation Initiation: 1. mRNA leaves the nucleus and binds to a ribosome 2. The two ribosomal subunits come together at the 5’ end of the mRNA. 3. Ribosome will find the start Codon (AUG) and the first tRNA molecule will attach  This is the only tRNA that will attach to the P site (and skip the A site)  The first amino acid is always methionine. Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

48. tRNA  tRNA has an anticodon that matches the codon on the mRNA strand  Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

49. Steps to Translation (Cont.) Elongation: 4. Amino acids attached to a tRNA molecules are brought over to the mRNA, and load in at the A site of the ribosome. 5. A polypeptide bond is formed between the amino acids in the P and A sites of ribosome. 6. Ribosome shifts over, opening up the A site for a new tRNA molecule. 7. tRNA in the E site leaves, leaving behind the amino acid.

50. Steps to Translation (Cont.) Termination:  8.Translation is terminated when a stop codon is reached. There are three different stop codons UGA, UAA, UAG.  9. The release factor recognizes the stop codon, attaches to the mRNA strand in the A site of ribosome, and releases the polypeptide strand. All the factors break apart and can be reused again.

52. Translation Animations  http://www.stolaf.edu/people/giannini/flashanimat/m olgenetics/translation.swf http://www.stolaf.edu/people/giannini/flashanimat/m olgenetics/translation.swf  https://www.youtube.com/watch?v=JTc18Yh7bSU https://www.youtube.com/watch?v=JTc18Yh7bSU

55. Think-Pair-Share  The mRNA sequence reads the following codons: What amino acids do they stand for?  AUG  GGA  GAG  CAA ** What amino acid does the anticodon CGU stand for?***

56. Think – Pair - Share  Find the amino acid sequence for the following mRNA sequence (translation)  AUGCGACGAAUUUAA

57. Do Now  Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT Do Translation- Remember to start the right place!

58. 1.2.3.

59. 4. 5. 6.

61. Do Now  Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA).  Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop  What do you notice about your DNA sequences?

62. Do Now  Template strand of DNA:  5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’  Remove the introns: CUCAUC  Determine protein sequence

63. How do cells know what protein to make when?  Gene Regulation: ability of an organism to control which genes are transcribed.

64. Controlling Transcription  Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts  The complex structure of eukaryotic DNA also regulate transcription.

65.  Everyone develops from a zygote  Zygote undergoes mitosis  Cell differentiation: cells become specialized  Certain gene sequences determine cell differentiation ……But how does that happen?

66. HOX Genes Homeobox Genes (Hox Genes) are sequences of DNA that are responsible for the general body pattern of most animals. Are transcribed at specific times, and located in specific places on the genome. Control what body part will develop in a given location.

67. Telephone  We are going to play the game telephone.  Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)

68. Mistakes in DNA  Cell make mistakes in replication, and transcription  Most often these mistakes are fixed  When these mistakes aren’t fixed, it causes a mutation.  A permanent change that occurs in a cell’s DNA is called a mutation.

69. Point Mutation  Substitution: A change in just one base pair  Missense Mutation: amino acid is change  Nonsense Mutation: amino acid is changed to a stop codon  Cause translation to terminate early.  Usually leads to proteins that can’t function normally.  Silent Mutation: change codes for same amino acid and cause no change in protein produced.

70. Frameshift Mutations  Causes the reading frame to shift to the left or the right  Insertion: Addition of a nucleotide  Deletion: Removal of a nucleotide

72. ACGAAATACAGACAT  Decide what type of mutation occurred:  ACGAAATAGAGACAT  ACAAATACAGACAT  ACGAAATACAGGACAT

74. Causes of Mutations  Mutations can happen spontaneously  Mutagens: Certain chemicals or radiation that can cause DNA damage  Causes bases to mispair and bond with the wrong base  High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.

75. Sex Cell vs. Somatic Cell Mutations  Somatic cell mutations are not passed on to the next generation.  Mutations that occur in sex cells (gamete cells) are passed on to the organism’s offspring and will be present in every cell of the offspring

78. Chromosomal Mutations Inversion: Piece of chromosome can be broken off, duplicated, or moved to another chromosome

79. Fragile X Syndrome  Repeat of CGG about 30 times  Causes mental and behavior impairments

81. Protein Folding and Stability  Substitutions also can lead to genetic disorders.  Ex. Sickle Cell Anemia (caused by a substitution mutation)  Can change both the folding and stability of the protein

82. Sickle Cell Anemia