1. DNA HISTORY, STRUCTURE, AND REPLICATION

2. Bellwork 1.List as many things from memory as you can about the structure of DNA (example: it’s a long chain) 2.What is the procedure for getting absent work & making up your BW points when you’re absent? 3. Leave BW on desk to be stamped. Begin cutting your model pieces @ your lab table (15 minutes). Each person needs: 4 blue 4 yellow 1 green 1 white 1 pink 1 purple

3. DNA Functions! Deoxyribonucleic acid (DNA) has two major functions… 1)Store and use information to run the cell- the “brain” 2)To replicate (copy) itself for cell division …and of course, to make you special! Deoxyribonucleic acid

4. DNA Structure 1.DNA is 2 long chains twisted around each other This creates a “double helix” shape (aka twisted ladder) Draw a picture of a double helix in your notes

5. Rosalind Franklin 1920-1958 Hey, I figured that out!

6. Rosalind Franklin 1952 Crystallized the DNA molecule Took an X-Ray Photo of it She concluded: DNA is helical DNA has “rungs”

7. Rosalind Franklin 1952 Crystallized the DNA molecule Took an X-Ray Photo of it She concluded: DNA is helical DNA has “rungs” On the back of your note taker summarize Rosalind Franklin’s contribution to our knowledge about DNA

8. DNA Paper Model Can you arrange your pieces into 2 chains? Try it out! (think about what the flat/untwisted version of a double helix would look like)

9. DNA Structure 2. DNA is made of 4 similar, but different subunits Each subunit is called a nucleotide. Nucleotides have 3 parts: Deoxyribose (sugar) Phosphate Nitrogenous Base (A, T, G or C)

10. DNA Paper Model Try to make 4 nucleotides out of your DNA pieces. Think about what 3 things must be in EACH nucleotide.

11. A Nucleotide Draw a picture of a nucleotide on your notes

12. Count the nucleotides!

13. A nucleotide is three things that work as one unit. (sugar, phosphate, N-base) We think of a hub, spokes, and a rim as a wheel. You can separate these parts, and take them apart one by one, but usually you find them together in a unit called a wheel.

14. DNA Structure Nucleotides are joined together with strong covalent bonds, forming long strands

15. Paper model Make ONE strand of DNA down the left side of your paper (4 nucleotides long). Glue it into place once approved. When you are finished, help someone else complete their paper model

16. Put your name on your paper model Circle ONE nucleotide

17. Closure Write one complete sentence about what you learned for each letter: D- N- A-

18. Sponge Nucleotide video (0:41): http://www.youtube.com/watch?v=PFYp9 Gfg3Y4 http://www.youtube.com/watch?v=PFYp9 Gfg3Y4 Rosalind Franklin video (2:24): http://www.youtube.com/watch?v=y6k1jpQIl EU

19. Bellwork 1.What is the scientific name for the subunits of DNA? 2.What are the 3 parts of each subunit? 3.Describe a time in your life when you had to use a code. Why did you need a CODE and how did it help? 4.Begin cutting your model pieces. For today you need another 4 blue, 4 yellow, 1 green, 1 white, 1 pink, 1 purple (15 mins)

20. DNA Structure 3. The order of subunits on one strand determines the order of subunits on the complementary strand Chargaff’s Rule: On opposite strands, A always pairs with T C always pairs with G

21. Erwin Chargaff 1905-2002 I got a rule named after me!

22. Erwin Chargaff 1950 Took DNA samples & broke them apart Analyzed the amount of each nitrogenous base (A,T,G,C) He concluded: A = T G = C

23. Erwin Chargaff 1950 Took DNA samples & broke them apart Analyzed the amount of each nitrogenous base (A,T,G,C) He concluded: A = T G = C On the back of your note taker summarize Erwin Chargaff’s contribution to our knowledge about DNA

24. Come up with a memory strategy for Chargaff’s Rule A-T C-G

25. Practice Chargaff’s Rule On your note taker, complete the second strand of DNA using Chargaff’s Rule

26. Chargaff’s Rule Label the deoxyribose sugars with “D” Label the phosphates with “P” Circle one nucleotide D D D D D D D DD D D D D D DD P P P P P P P P P P P P P P P P

27. DNA Structure The two strands are held together by weak hydrogen bonds between the nitrogenous base-pairs. Label one of the hydrogen bonds on your Chargaff’s Rule picture

28. Paper model Use Chargraff’s rule to make a complementary strand of DNA & connect it to the first strand. Glue it down once approved. After you finish, help other students finish their models. What do you notice about the complementary strands?

29. James Watson and Francis Crick 1953 We won the Nobel Prize!

30. Watson and Crick 1953 -Used all info & Franklin’s photograph & Chargaff’s Rule to accurately model the structure of DNA (just like you did!) -Included double helix with “rungs” -“Rungs” held together by Hydrogen Bonds

31. Watson & Crick shared the Nobel Prize for the discovery of DNA structure On the back of your note taker summarize James Watson & Francis Crick’s contribution to our knowledge of DNA

32. Closure: How is DNA like a piece of yarn? Write a PIE paragraph response in your notebook. Give specific examples.

33. Have slate, marker & eraser on desk Bellwork Have slate, marker & eraser on desk 1. What is the scientific name for the “subunits” of DNA? 1.What are the 3 parts of each subunit? 2.What is Chargraff’s Rule? 3.Copy the strand of DNA on the right and write the complementary strand next to it, using to Chagfraff’s Rule. 4.Write one note about each of the following scientist’s contributions: Franklin, Chargaff, Watson & Crick AGTCAATGCGAGTCAATGCG TCAGTTACGCTCAGTTACGC

34. DNA Replication

35. DNA copies itself in 3 steps

36. Step 1- DNA Unzips DNA HelicaseDNA Helicase (enzyme) splits apart the two chains of DNA Draw a picture of step 1 on your note taker

38. What is the first step of replication? Please unzip the two chains of your DNA model What did the scissors represent while we unzipped the model? –DNA Helicase

39. Each strand acts as a pattern or template for the new strands DNA PolymeraseDNA Polymerase takes free nucleotides makes new strands using Chargaff’s Rules Step 2- Bases Pair Up Draw a picture of step 2 on your note taker

41. What is the second step of replication? Please draw the complementary strands for each of the parent chains What does parent chain mean? What could we call the new chains if the original ones are called “parents”? What represented the DNA polymerase enzyme when we made the new strands?

42. Enzymes double check new daughter strands for errors, & fix if needed Sugar-phosphate backbone bonds tightly Step 3- Check & Bond Draw a picture of step 3 on your note taker

44. What is the third step of replication? Please glue the strands together and double check for errors in your 2 new sets of DNA What represented the enzymes that double check for errors in your model?

45. This DNA replication process is so accurate that errors are rare (1 in a billion) and when errors do occur they are often corrected by special repair enzymes. This repair allows for accurate replication as organisms grow and reproduce generation after generation. If you did a task once every minute for the rest of your life, and made that few mistakes, you would only make one mistake every 30 years!If you did a task once every minute for the rest of your life, and made that few mistakes, you would only make one mistake every 30 years!

46. Label your model Put your name at the top of your two new sets of DNA Label the parent strand, and label the daughter strand Circle and label a nucleotide on one of the daughter strands

47. Homework- due Friday 1.Replicate the other parent strand using the 3 steps 2.Label the parent strand & daughter strand 3.Label a nucleotide on the daughter strand

48. Closure How would you explain the process of DNA replication to a 1 st grader? Write out a short paragraph in simple language and include simplified drawings (little kids often understand drawings better than words).