1. ©2000 Timothy G. Standish Ecclesiastes 3:1 1To every thing there is a season, and a time to every purpose under the heaven:

2. ©2000 Timothy G. Standish Initiation of Transcription Timothy G. Standish, Ph. D.

3. ©2000 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some gene products are needed by all cells all the time. These constitutive genes are expressed by all cells. Other genes are only needed by certain cells or at specific times, expression of these inducible genes is tightly controlled in most cells. For example, pancreatic  cells make insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.

4. ©2000 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together

5. ©2000 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter. Production of lactose metabolizing enzymes when not needed would be wasteful Metabolizing lactose for energy only makes sense when two criteria are met: 1Other more readily metabolized sugar (glucose) is unavailable 2Lactose is available

6. ©2000 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: –LacZ -  -galactosidase - Hydrolizes the bond between galactose and glucose –LacY - Codes for a permease that lets lactose across the cell membrane –LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain –Repressor - A protein that works with the control region to control expression of the operon

7. ©2000 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: 1 Promoter –These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur –The lac operon promoter also has a binding site for another protein called CAP 2 Operator –The binding site of the repressor protein –The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

8. ©2000 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose RepressorPromoter LacYLacALacZ Operator CAP Binding RNA Pol. Repressor mRNA Hey man, I’m constitutive Come on, let me through No way Jose! CAP

9. ©2000 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP Lac Repressor X RNA Pol. RNA Pol. Great, I can transcribe! Some transcription occurs, but at a slow rate This lactose has bent me out of shape

10. ©2000 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP cAMP Lac Repressor X This lactose has bent me out of shape CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. RNA Pol. Yipee…!

11. ©2000 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present RepressorPromoter LacYLacALacZ Operator CAP Binding CAP cAMP CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. Repressor mRNA Hey man, I’m constitutive Repressor STOP Right there Polymerase Alright, I’m off to the races... Come on, let me through!

12. ©2000 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: –Using a repressor that works in exactly the opposite way from the lac operon repressor –Using a special attenuator sequence

13. ©2000 Timothy G. Standish The Tryptophan Biochemical Pathway O - OOC OH HN H H -2 O 3 P OH H H CH 2 O 5-Phosphoribosyl-  -Pyrophosphate PP i N-(5’- Phosphoribosyl) -anthranilate COO - H CH 2 C HO H O Chorismate - OOC OH -2 O 3 POCH 2 NHNH CHCH CC H OH C H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate NHNH - OOCCH 2 NH 3+ C H Tryptophan H2OH2O Serine Antrhanilate COO - NH 2 Glutamate + Pyruvate Glutamine CO 2 +H 2 O -2 O 3 POCH 2 CHCH CC H OH C H NHNH Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate NHNH Indole Anthranilate synthetase (trpE and D) Anthranilate synthetase N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase Tryptophan synthetase

14. ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Present STOP Right there Polymerase Trp Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. RNA Pol. Foiled Again! Repressor mRNA Hey man, I’m constitutive

15. ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

16. ©2000 Timothy G. StandishAttenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

17. ©2000 Timothy G. Standish 3’ 5’ 3’ Transcription And Translation In Prokaryotes Ribosome 5’ mRNA RNA Pol.

18. ©2000 Timothy G. Standish Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU- UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA- AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGA GCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA- AAA-CCG trpE... Terminator The Trp Leader and Attenuator 4 12 3

19. ©2000 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 4 1 2 3 Terminator hairpin 4 12 3

20. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Starved For Tryptophan 4 1 2 3 RNA Pol. Ribosome Help, I need Tryptophan

21. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present 4 1 2 3 RNA Pol. Ribosome RNA Pol.

22. ©2000 Timothy G. Standish Expression Control In Eukaryotes Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes

23. ©2000 Timothy G. Standish Eukaryotes Have Large Complex Genomes The human genome is about 3 x 10 9 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6 x 10 9 base pairs or ≈ 2 m of DNA Some gene families are located close to one another on the same chromosome Genes with related functions appear to be distributed almost at random throughout the the genome

24. ©2000 Timothy G. Standish Highly Packaged DNA Cannot be Expressed Because of its size, eukaryotic DNA must be packaged Heterochromatin, the most highly packaged form of DNA, cannot be transcribed; therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate areas of active gene expression

25. ©2000 Timothy G. Standish Only a Subset of Genes is Expressed at any Given Time It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time.

26. ©2000 Timothy G. Standish DNA Cytoplasm Nucleus G AAAAAA Export Degradation etc. G AAAAAA Control of Gene Expression G AAAAAA RNA Processing mRNA RNA Transcription Nuclear pores Ribosome Translation Packaging Modification Transportation Degradation

27. ©2000 Timothy G. Standish Logical Expression Control Points DNA packaging Transcription RNA processing mRNA Export mRNA masking/unmasking and/or modification mRNA degradation Translation Protein modification Protein transport Protein degradation Increasing cost The logical place to control expression is before the gene is transcribed

28. ©2000 Timothy G. Standish Three Eukaryotic RNA Polymerases 1 RNA Polymerase I - Produces rRNA in the nucleolus, accounts for 50 - 70 % of transcription 2 RNA Polymerase II - Produces mRNA in the nucleoplasm - 20 - 40 % of transcription 3 RNA Polymerase III - Produces tRNA in the nucleoplasm - 10 % of transcription

29. ©2000 Timothy G. Standish A “Simple” Eukaryotic Gene Terminator Sequence Promoter/ Control Region Transcription Start Site 5’ Untranslated Region 3’ Untranslated Region Exons Introns 3’5’ Exon 2Exon 3 Int. 2 Exon 1 Int. 1 RNA Transcript

30. ©2000 Timothy G. Standish 5’ DNA 3’ Enhancers EnhancerTranscribed Region 3’ 5’ TF 3’ 5’ TF 5’ RNA Pol. RNA Pol. Many bases Promoter

31. ©2000 Timothy G. Standish Eukaryotic RNA Polymerase II RNA polymerase is a very fancy enzyme that does many tasks in conjunction with other proteins RNA polymerase II is a protein complex of over 500 kD with more than 10 subunits:

32. ©2000 Timothy G. Standish Eukaryotic RNA Polymerase II Promoters Several sequence elements spread over about 200 bp upstream from the transcription start site make up RNA Pol II promoters Enhancers, in addition to promoters, influence the expression of genes Eukaryotic expression control involves many more factors than control in prokaryotes This allows much finer control of gene expression

33. ©2000 Timothy G. Standish RNA Pol. IIInitiation T. F. RNA Pol. II 5’ mRNA Promoter T. F.

34. ©2000 Timothy G. Standish Eukaryotic Promoters 5’ Exon 1 Promoter Sequence elements ~200 bp TATA ~-25 Initiator “TATA Box” Transcription start site (Template strand) -1+1 SSTATAAAASSSSSNNNNNNNNNNNNNNNNNYYCAYYYYYNN S = C or G Y = C or T N = A, T, G or C

35. ©2000 Timothy G. Standish Initiation TFIID Binding -1+1 Transcription start site TFIID “TATA Box” TBP Associated Factors (TAFs) TATA Binding Protein (TBP)

36. ©2000 Timothy G. Standish Initiation TFIID Binding TFIID 80 o Bend -1+1 Transcription start site

37. ©2000 Timothy G. Standish Initiation TFIIA and B Binding TFIID TFIIA -1+1 Transcription start site TFIIB

38. ©2000 Timothy G. Standish Initiation TFIIF and RNA Polymerase Binding TFIID TFIIA -1+1 Transcription start site TFIIB RNA Polymerase TFIIF

39. ©2000 Timothy G. Standish Initiation TFIIE Binding TFIID TFIIA -1+1 Transcription start site RNA Polymerase TFIIB TFIIF TFIIE TFIIE has some helicase activity and may by involved in unwinding DNA so that transcription can start

40. ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding TFIID TFIIA -1+1 Transcription start site RNA Polymerase TFIIB TFIIF TFIIE TFIIH has some helicase activity and may by involved in unwinding DNA so that transcription can start TFIIH P P P TFIIJ

41. ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding TFIID TFIIA -1+1 Transcription start site RNA Polymerase TFIIB TFIIF TFIIE TFIIH P P P TFIIJ

42. ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding -1+1 Transcription start site RNA Polymerase P P P

43. ©2000 Timothy G. Standish