Download presentation
Presentation is loading. Please wait.
Published byNorman Stone Modified over 9 years ago
2
How do you handle huge amounts of information?
3
When looking in an encyclopedia you use an index When biologists search the volumes of the human genome using sequences of DNA bases.
4
Testing for alleles You suspect you might be carrying recessive alleles for a genetic disorder like cystic fibrosis or Tay- Sachs disease, how can you find out???
5
Both of them are slightly different DNA sequences from their normal counterparts, a variety of genetic tests have been develop.
6
These are specific DNA base sequences that detect the complementary base sequences found in the disease- causing allele
7
Test also detect differences between the lengths of normal and abnormal alleles.
8
Genetic tests are now available for hundreds of disorders. DNA testing can pinpoint the exact genetic basis of a disorder, making it possible to develop more effective treatment for individuals affected by genetic disease.
9
DNA Fingerprinting It does not analyze the cell’s most important genes, which are largely identical among most people. It analyze sections of DNA that have little or no known function but vary widely from one individual to another. Except, identical twins
12
The Human Genome Project DNA sequencing technologies made it possible, for the first time, to sequence entire genomes. The Human Genome Project is an ongoing effort to analyze the human DNA sequence.
13
Rapid Sequencing First scientist determined the sequence of bases in widely separated regions of DNA. This regions were then used as markers and made it possible to locate and return specific locations in the genome.
14
“shotgun sequencing” involves cutting DNA into random fragments and determine the sequence of bases in each fragment. Computers found areas of overlap between the fragments and put the fragments together by linking the overlapping areas.
15
The computers then aligned the fragments relative to the known markers on each chromosome. AAATTTGGGCCCCCGGGAAAT CCCGGGAAATGGATCGATG
16
This process is like putting a jigsaw puzzle. But you match identical base sequences.
17
Searching for Genes Only one part of a human DNA molecule is made of genes. I contains aprox 25,000 genes. Fruit fly has aprox. 14,000 genes Worm has aprox. 20,000 genes.
18
One method to find genes is by finding DNA sequences that are known to be promoters that are binding sites for RNA polymerase. Promoters indicate the start of a gene. Then it starts the reading of the gene. For most genes the mRNA coding regions or exons have also introns regions.
19
Looking for genes that may provide useful clues to some of the basic properties of life.
20
All the data base on human genome is available to everybody.
21
Gene Therapy Is the process of changing the gene that causes a genetic disorder. In gene therapy, an absent or faulty gene is replaced by a normal, working gene. - This way the body can make the correct protein or enzyme it needs, which eliminates the cause of the disorder.
22
One authorized attempt to cure In 1990 a young girl was apparently cured on an inherited immune disorder when bone marrow were removed, modified and then placed back in the body.
23
Scientists do not know how long the beneficial effect of this treatment will last.
24
There has been attempts for cystic fibrosis but have not produced a lasting cure. Gene therapy remains a high-risk, experimental procedure.
25
Ethical Issues in Human Genetics It would be marvelous to be able to cure hemophilia or other genetic diseases. But if human cells can be manipulated to cure disease, should biologist try to engineer taller people or eye color, or appearance?
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.