Presentation is loading. Please wait.

Presentation is loading. Please wait.

E. coli 0157:H7: A New Emerging Disease

Similar presentations


Presentation on theme: "E. coli 0157:H7: A New Emerging Disease"— Presentation transcript:

1

2 E. coli 0157:H7: A New Emerging Disease
1982: First recognized as pathogen 1983: Linked to hemolytic uremic syndrome 1990: Outbreak from drinking water 1991: Outbreak from apple cider 1993: Large outbreak from hamburgers

3 E. coli 0157:H7: Clinical Manifestations
Condition Asymptomatic carriage Nonbloody diarrhea Hemorrhagic colitis Hemolytic-uremic syndrome Complications of enteric infection Frequency Unknown 10% 90% 10% <10 years <5% Clin Infect Dis 1995;20:1

4 Barium-enema showing “thumbprinting” in colon of child with E
Barium-enema showing “thumbprinting” in colon of child with E. coli O157:H7 hemorrhagic colitis, due to edema and submucosal hemorrhage N Engl J Med 1995;333:364

5 Colonic biopsy from patient with E. coli O157:H7 infection
Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane N Engl J Med 1995;333:364

6 Hemolytic Uremic Syndrome
Days to 2 weeks after gastroenteritis Pallor, bruising, lethargy Anemia (Hgb=5-7 mg/dl), thrombocytopenia Hematuria, acute renal failure Death: 3%-5% E. coli O157:H7 isolated from 96% of patients when culture performed within 6 days of onset

7 Pathogenesis of E. coli O157:H7 infection

8 Incidence of E. coli O157:H7 infection, United States
Source: CDC

9 Outbreaks of E. coli 0157:H7 reported to CDC, 1982-1994
Vehicle Ground beef All beef + milk Water (drinking/swimming) Person-to-person Unknown All outbreaks No. outbreaks 22 26 3 9 19 69 No. persons 1,137 1,278 276 243 274 2,334 Epidemiol Rev 1996;18:29

10 Outbreaks of E. coli 0157:H7 reported to CDC, 1982-1994
Epidemiol Rev 1996;18:29

11 E. coli 0157:H7: Vehicles of infection
Undercooked hamburgers Bovine manure Contaminated water (e.g., lakes, water slides) Alfalfa sprouts Mayonaise Unpasteurized apple cider Unpasteurized milk

12 E. coli 0157:H7 in food Present in any food w/bovine fecal contamination Infectious dose: probably <5 organisms Present in 1%-2% of ground beef, pork, poultry, lamb retail meat samples in Madison, WI Present in about 10% of raw milk samples Epidemiol Rev 1996;18:29

13 Geographic distribution of E
Geographic distribution of E. coli O157:H7: Total Number of Reported Cases, 1996

14 Cases of foodborne illness, selected pathogens, 1995
Salmonella Campylobacter E. coli O157:H7 Clostridium perfringens Listeria monocytogenes Staphylococcus aureus Cases 696,000-3,840,000 1,100,000-7,000,000 8,000-16,000 10,000 928-1,767 1,513,000 Deaths 870-1,920 100 454

15 Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb
Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington State Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases 631 cases reported (501 cult. confirmed) Median age 8 45 cases of HUS, 3 died Median incubation 4 days Undercooked burgers at “chain A”, 58/64 restaurants had at least 1 case Burgers cooked 1 minute/side: routinely associated with internal temp. <68.3 C Molecular epidemiology: single clone Click for larger picture JAMA 1994;272:1349

16 E. coli 0157:H7 at the Washington County Fair, New York, 1999
921 persons reported diarrhea E. coli 0157:H7 isolated from 116 persons; 13 coinfected with Campylobacter jejuni 32 infected with C. jejuni alone 65 persons hospitalized, 11 children w/HUS 2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP Source: consumption of water from shallow unchlorinated well MMWR 1999;48:803

17 Outbreak of E. coli O157:H7 Among Children Associated With Farm Visits – Montgomery County, PA, 2000
September-November 2000: Montgomery County HD identified 51 persons with diarrhea <10 days of visiting a dairy farm (farm A) Age range 1-52 years (median: 4 years) Bloody diarrhea (37%), fever (45%), vomiting (45%) 16 patients were hospitalized and eight developed HUS MMWR 2001;50:293

18 Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Molecular Epidemiology
Isolates from patients indistinguishable by PFGE All 216 cattle on Farm A cultured by rectal swab 28 (13%) positive for outbreak strain Same strain isolated from railing surface MMWR 2001;50:293

19 CDC Investigator Examines a Calf at “Farm A”, Pennsylvania, 2000
MMWR 2001;50:293

20 Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Case-Control Study of Risk Factors Exposure Contact with cattle Nailbiting Food from concession Handwashing before eating Odd ratio (95% CI) 10.9 ( ) 2.5 ( ) 0.2 ( ) MMWR 2001;50:293

21 Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995 N Engl J Med 1997;337:388

22 Patterns on Pulsed-Field Gel Electrophoresis of E
Patterns on Pulsed-Field Gel Electrophoresis of E. coli O157:H7 in Minnesota Lanes 1, 6, 10: E. coli 0157:H7 standard Lane 5: add. mole. wt. standard Lanes 2, 4, 7, 8: sporadic cases Lanes 3, 9: isolates from single cluster N Engl J Med 1997;337:388

23 Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995 N Engl J Med 1997;337:388 Click for larger picture

24 Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1994 Click for larger picture N Engl J Med 1997;337:388

25 Confirmed E. coli O157:H7 outbreaks in Minnesota, 1994 and 1995
N Engl J Med 1997;337:388 Click for larger picture

26 Molecular subtyping of E
Molecular subtyping of E. coli 0157:H7 has revolutionized population-based surveillance for this organism in Minnesota. We now routinely subtype all E. coli 0157:H7 isolates and consider this technique to be an integral part of disease prevention and control in our state. Minnesota Department of Health N Engl J Med 1997;377:388

27 The Colorado Department of Public Health recently identified an outbreak of E. coli 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 E. coli isolates submitted for routine molecular subtyping since June 1 were characterized by highly related PFGE patterns. . . CDC MMWR 1997;46:777.

28 PFGE patterns of Salmonella enterica serotype Typhimurium, by Week, Minnesota, June - September 1995
Click for larger picture N Engl J Med 2001; 344:189

29 National network of PH labs that performs PFGE on foodborne bacteria
Coordinated by CDC National network of PH labs that performs PFGE on foodborne bacteria Salmonella serotype Typhimurium Escherichia coli 0157:H7 Others planned Permits rapid comparison of PFGE patterns through electronic database at CDC Pennsylvania Department of Health participates

30 Prevention Surveillance for E. coli 0157:H7 and HUS
Modernization of food inspection Education of physicians Education of public

31 Limitations of Pulsed-Field Gel Electrophoresis
Substantial intra-/inter-laboratory variation Interpretation of banding patterns subjective Requires additional enzymes to prove “matches” Analyzing across gels difficult PFGE stored as large image files Requires isolation of the organism Slow Ongoing, automated computer analysis difficult

32 Chain Termination DNA Sequencing (Sanger Method)
A: New DNA synthesized as polymerase moves down template DNA, away from primer B: Nucleotides added until dideoxynucleotide incorporated. C: Labeled primer D: Labeled deoxynucleotides Click for larger picture E: Labeled dideoxynucleotides

33 Multilocus Sequence Typing (MLST)
Sequencing of multiple housekeeping genes State of the art (human genome project) Objective: no need to compare banding patterns Standardization of methods Fully reproducible Storage, transmission, analysis of ASCII files More appropriate for ongoing, automated computer analysis Do not need to isolate organism in culture Fast

34 TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC
Sequence v. PFGE Data TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC

35 Serratia marcescens outbreak in a NICU
Strain A isolates Mar-Jul 1995, 23 cases Mostly sepsis, 30% died 2 simultaneous outbreaks Most strain “A”, 4 “E” Contamination between NICU (*) and 2 other wards (** and ***) * * ** * * *** ** * * J Clin Microbiol 1996;34:3138

36 Cluster of Serogroup C Meningococcal Disease Associated With a Party
Case year-old male with headache, fever, nausea, vomiting on May 19, On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis. Case year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis. Case year-old male, with headache, neck pain, vomiting, hypotension on May 25, Blood cultures positive for N. meningitidis Common exposure: Attendance at a (wild!) party on May 14 S Med J, in press

37 Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE Analaysis (SpeI)
Lanes 1, 6, 10: lambda ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group C N. meningitidis control isolates from 1999 S Med J, in press

38 Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks: Summary
Routine molecular subtyping of key pathogens of public health importance leads to enhanced detection of foodborne outbreaks Routine molecular subtyping should be an integral part of public health surveillance DNA sequence-based methods may eventually replace restriction enzyme-based methods


Download ppt "E. coli 0157:H7: A New Emerging Disease"

Similar presentations


Ads by Google