2. E. coli 0157:H7: A New Emerging Disease
1982: First recognized as pathogen
1983: Linked to hemolytic uremic syndrome
1990: Outbreak from drinking water
1991: Outbreak from apple cider
1993: Large outbreak from hamburgers

3. E. coli 0157:H7: Clinical Manifestations
Condition
Asymptomatic carriage
Nonbloody diarrhea
Hemorrhagic colitis
Hemolytic-uremic syndrome
Complications of enteric infection
Frequency
Unknown
10%
90%
10% <10 years
<5%
Clin Infect Dis 1995;20:1

4. Barium-enema showing “thumbprinting” in colon of child with E
Barium-enema showing “thumbprinting” in colon of child with E. coli O157:H7 hemorrhagic colitis, due to edema and submucosal hemorrhage
N Engl J Med 1995;333:364

5. Colonic biopsy from patient with E. coli O157:H7 infection
Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane
N Engl J Med 1995;333:364

6. Hemolytic Uremic Syndrome
Days to 2 weeks after gastroenteritis
Pallor, bruising, lethargy
Anemia (Hgb=5-7 mg/dl), thrombocytopenia
Hematuria, acute renal failure
Death: 3%-5%
E. coli O157:H7 isolated from 96% of patients when culture performed within 6 days of onset

7. Pathogenesis of E. coli O157:H7 infection

8. Incidence of E. coli O157:H7 infection, United States
Source: CDC

9. Outbreaks of E. coli 0157:H7 reported to CDC, 1982-1994
Vehicle
Ground beef
All beef + milk
Water (drinking/swimming)
Person-to-person
Unknown
All outbreaks
No. outbreaks 22 26 3 9 19 69
No. persons
1,137
1,278
276
243
274
2,334
Epidemiol Rev 1996;18:29

10. Outbreaks of E. coli 0157:H7 reported to CDC, 1982-1994
Epidemiol Rev 1996;18:29

11. E. coli 0157:H7: Vehicles of infection
Undercooked hamburgers
Bovine manure
Contaminated water (e.g., lakes, water slides)
Alfalfa sprouts
Mayonaise
Unpasteurized apple cider
Unpasteurized milk

12. E. coli 0157:H7 in food
Present in any food w/bovine fecal contamination
Infectious dose: probably <5 organisms
Present in 1%-2% of ground beef, pork, poultry, lamb retail meat samples in Madison, WI
Present in about 10% of raw milk samples
Epidemiol Rev 1996;18:29

13. Geographic distribution of E
Geographic distribution of E. coli O157:H7: Total Number of Reported Cases, 1996

14. Cases of foodborne illness, selected pathogens, 1995
Salmonella
Campylobacter
E. coli O157:H7
Clostridium perfringens
Listeria monocytogenes
Staphylococcus aureus
Cases
696,000-3,840,000
1,100,000-7,000,000
8,000-16,000
10,000
928-1,767
1,513,000
Deaths
870-1,920
100
454

15. Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb
Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington State
Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases
631 cases reported (501 cult. confirmed)
Median age 8
45 cases of HUS, 3 died
Median incubation 4 days
Undercooked burgers at “chain A”, 58/64 restaurants had at least 1 case
Burgers cooked 1 minute/side: routinely associated with internal temp. <68.3 C
Molecular epidemiology: single clone
Click for larger picture
JAMA 1994;272:1349

16. E. coli 0157:H7 at the Washington County Fair, New York, 1999
921 persons reported diarrhea
E. coli 0157:H7 isolated from 116 persons; 13 coinfected with Campylobacter jejuni
32 infected with C. jejuni alone
65 persons hospitalized, 11 children w/HUS
2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP
Source: consumption of water from shallow unchlorinated well
MMWR 1999;48:803

17. Outbreak of E. coli O157:H7 Among Children Associated With Farm Visits – Montgomery County, PA, 2000
September-November 2000: Montgomery County HD identified 51 persons with diarrhea <10 days of visiting a dairy farm (farm A)
Age range 1-52 years (median: 4 years)
Bloody diarrhea (37%), fever (45%), vomiting (45%)
16 patients were hospitalized and eight developed HUS
MMWR 2001;50:293

18. Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Molecular Epidemiology
Isolates from patients indistinguishable by PFGE
All 216 cattle on Farm A cultured by rectal swab
28 (13%) positive for outbreak strain
Same strain isolated from railing surface
MMWR 2001;50:293

19. CDC Investigator Examines a Calf at “Farm A”, Pennsylvania, 2000
MMWR 2001;50:293

20. Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Case-Control Study of Risk Factors
Exposure
Contact with cattle
Nailbiting
Food from concession
Handwashing before eating
Odd ratio (95% CI)
10.9 ( )
2.5 ( )
0.2 ( )
MMWR 2001;50:293

21. Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995
N Engl J Med 1997;337:388

22. Patterns on Pulsed-Field Gel Electrophoresis of E
Patterns on Pulsed-Field Gel Electrophoresis of E. coli O157:H7 in Minnesota
Lanes 1, 6, 10: E. coli 0157:H7 standard
Lane 5: add. mole. wt. standard
Lanes 2, 4, 7, 8: sporadic cases
Lanes 3, 9: isolates from single cluster
N Engl J Med 1997;337:388

23. Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995
N Engl J Med 1997;337:388
Click for larger picture

24. Routine DNA Fingerprinting by Health Departments: E
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1994
Click for larger picture
N Engl J Med 1997;337:388

25. Confirmed E. coli O157:H7 outbreaks in Minnesota, 1994 and 1995
N Engl J Med 1997;337:388
Click for larger picture

26. Molecular subtyping of E
Molecular subtyping of E. coli 0157:H7 has revolutionized population-based surveillance for this organism in Minnesota. We now routinely subtype all E. coli 0157:H7 isolates and consider this technique to be an integral part of disease prevention and control in our state.
Minnesota Department of Health N Engl J Med 1997;377:388

27. The Colorado Department of Public Health recently identified an outbreak of E. coli 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 E. coli isolates submitted for routine molecular subtyping since June 1 were characterized by highly related PFGE patterns. . .
CDC MMWR 1997;46:777.

28. PFGE patterns of Salmonella enterica serotype Typhimurium, by Week, Minnesota, June - September 1995
Click for larger picture
N Engl J Med 2001;
344:189

29. National network of PH labs that performs PFGE on foodborne bacteria
Coordinated by CDC
National network of PH labs that performs PFGE on foodborne bacteria
Salmonella serotype Typhimurium
Escherichia coli 0157:H7
Others planned
Permits rapid comparison of PFGE patterns through electronic database at CDC
Pennsylvania Department of Health participates

30. Prevention Surveillance for E. coli 0157:H7 and HUS
Modernization of food inspection
Education of physicians
Education of public

31. Limitations of Pulsed-Field Gel Electrophoresis
Substantial intra-/inter-laboratory variation
Interpretation of banding patterns subjective
Requires additional enzymes to prove “matches”
Analyzing across gels difficult
PFGE stored as large image files
Requires isolation of the organism
Slow
Ongoing, automated computer analysis difficult

32. Chain Termination DNA Sequencing (Sanger Method)
A: New DNA synthesized as
polymerase moves down template
DNA, away from primer
B: Nucleotides added until
dideoxynucleotide incorporated.
C: Labeled primer
D: Labeled deoxynucleotides
Click for larger picture
E: Labeled dideoxynucleotides

33. Multilocus Sequence Typing (MLST)
Sequencing of multiple housekeeping genes
State of the art (human genome project)
Objective: no need to compare banding patterns
Standardization of methods
Fully reproducible
Storage, transmission, analysis of ASCII files
More appropriate for ongoing, automated computer analysis
Do not need to isolate organism in culture
Fast

34. TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC
Sequence v. PFGE Data
TTCGAATAAGCTTCCCTGAG
AAGCTTATTCGAAGGGACTC

35. Serratia marcescens outbreak in a NICU
Strain A isolates
Mar-Jul 1995, 23 cases
Mostly sepsis, 30% died
2 simultaneous outbreaks
Most strain “A”, 4 “E”
Contamination between NICU (*) and 2 other wards (** and ***) * * ** * *
*** ** * *
J Clin Microbiol 1996;34:3138

36. Cluster of Serogroup C Meningococcal Disease Associated With a Party
Case year-old male with headache, fever, nausea, vomiting on May 19, On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis.
Case year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis.
Case year-old male, with headache, neck pain, vomiting, hypotension on May 25, Blood cultures positive for N. meningitidis
Common exposure: Attendance at a (wild!) party on May 14
S Med J, in press

37. Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE Analaysis (SpeI)
Lanes 1, 6, 10: lambda ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group C N. meningitidis control isolates from 1999
S Med J, in press

38. Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks: Summary
Routine molecular subtyping of key pathogens of public health importance leads to enhanced detection of foodborne outbreaks
Routine molecular subtyping should be an integral part of public health surveillance
DNA sequence-based methods may eventually replace restriction enzyme-based methods