1. Genetic Considerations in Broodstock Selection for Oyster Restoration, Aquaculture Development, and Non-native Species Introductions
Kimberly S. Reece

2. Virginia Oyster Landings 1880 - 2005

3. What is the best approach to restoration, protection and preservation of the oyster resource?

4. What is the goal of oyster restoration?
Preferred Approach May Depend on Motivations and Perspectives
What is the goal of oyster restoration?
Industry Restoration-objective to become profitable and self-sustaining
Ecological Restoration
To restore habitat and
populations of native oysters
To rebuild a sustainableharvest fishery
Develop a new oyster industry-aquaculture
Native oyster
Non-native oyster
Not necessary exclusive approaches, but emphasis and measures of success may differ

5. Possible Solutions
Oyster reef restoration- build/restore habitat (reefs) and establish sanctuaries.
Reefs provide substrate for natural spatfall, sanctuaries protect from fishing pressure.
Stock reefs with oysters from hatcheries-goal self-sustaining
wild broodstock
selected / domesticated strains?
Aquaculture development through improved selective breeding practices:
Enhanced disease tolerance
Enhanced growth rate
Consideration of alternative Crassostrea species for Chesapeake Bay aquaculture and maybe restoration of the fishery (or ecological restoration).
Asian oysters are significantly more resistant (tolerant) to MSX and Dermo.
Crassostrea ariakensis tested in Chesapeake Bay has shown:
rapid growth
taste that is acceptable to market
disease tolerance in field trials

6. Genetic Considerations
Stocking reefs with hatchery oysters
Does it work?
Is it a good idea from the genetics point of view?
Which oysters to use? Wild or Selected?
What is the genetic impact on extant natural populations?
Ultimate goal = self-sustaining populations, but of what genetic make-up.
Aquaculture Development
Which oyster stocks to use? Diploids or triploids?
Special genetic lines might be selected for particular traits of interest.
Maintain genetically healthy lines.
Is there any genetic impact on extant natural populations?
Introduction of a Non-native Oyster
Aquaculture or on bottom fishery?
Which species? Genetic identification needed.
Which stock? Broodstock source?
Oregon strain too genetically bottlenecked?

7. Genetic Considerations (Restoration)
Stocking reefs with hatchery oysters
Does it work?
Is it a good idea from the genetics point of view?
Which oysters to use? Wild or Selected?
What is the genetic impact on extant natural populations?
Ultimate goal = self-sustaining populations, but of what genetic make-up?

8. Should Reefs be Stocked?
Supportive breeding - adding hatchery broodstock to reefs to supplement natural populations.
If we do stock, what is the best broodstock?
Hatchery oysters from wild broodstock too wimpy? ie. Subject to high disease mortality?
Any selected line?
Different lines (or wild broodstock) be used for different systems/environments?
wild
selected
VIMS
I like a pale ale- 10 ppt
Make mine a stout-30 ppt

9. Genetic variation Natural spatfall- natural populations High
Hatchery oysters from wild broodstock
Selected lines
Highly inbred lines
High
Low
The answer to the questions of whether to stock and with what, depends on:
The genetic structure of the historical and the extant populations.
The phenotypic relevance of any detected genetic variation. Is there local adaptation?
The genetic impact of hatchery (planted) oysters on the wild populations and overall genetic variance (Ne).

10. New stress/challenge:
Do the disease-tolerant oysters, selected lines have a better chance of survival in the face of disease challenges?
Maybe yes, in the short term, but what about longer term?
Risks of inbreeding?
Environmental change
New stress/challenge:
Selected stock may not be able to survive different challenges-may really be “wimpy” under a different set of conditions.
Inbreeding may lead to increasing deleterious allele frequencies = line crash

11. Genetic diversity (higher effective population size) can be important for survival of a species
Environmental change = new stress/challenge and can results in elimination of some genetic types :
Others may survive:
Some “natural” populations are demonstrating disease tolerance.
Maybe these are a better source for supportive breeding broodstock

12. Shell Bar Reef, Great Wicomico River
June-September 2006: biweekly analysis of P. marinus in samples (each n = 25) of deployed DEBYs and naturally recruited C. virginica
P. marinus Weighted Prevalence
Carnegie and Burreson

13. York River-Disease Data
Cumulative mortality higher in Ross Rocks -- approaching 100% by September -- than in DEBYs (63% in October)
Cumulative mortality in Aberdeen Rocks (58% by October) similar to DEBYs; Wreck Shoals slightly higher (72%; MSX disease?)
Carnegie and Burreson

14. Motivations for, and the risks of, supportive breeding- using selected/hatchery stocks for restoration efforts.
Motivations
Increase the chances of survival/reproduction in the face of disease.
Genetic rehabilitation-introgression of “disease resistance” alleles into natural populations.
Ability to genetically track the success and dispersal patterns at restored sites-experiments to help design/improve restoration strategies.
However, (the risks)
Calculations and analyses indicate population bottlenecking possible by deploying highly inbred selected lines (Hare and Rose)
Little evidence to date that the selected lines are doing well and reproducing. Are we wasting $? (Carlsson et al.--stay tuned)
Evidence of resistance (tolerance) in natural populations (Carnegie and Burreson), which are genetically more diverse and therefore risk can be reduced by using wild broodstock.

15. Need Basic Genetic Data
Chesapeake Bay
What is the Crassostrea virginica population genetic structure?
Ongoing studies-published and preliminary results
What is the effective population size in CB and how would selectively bred stock impact this?
Matt Hare’s presentation on Thursday:high risk with current selected highly inbred lines with low Ne.
What are the larval dispersal patterns around restored reefs?

16. What is the genetic structure of the extant native oyster populations?
What historically was the genetic structure of the native oyster populations?
The BAYLOR SURVEY of OYSTER GROUNDS
1892 survey of most productive oyster grounds in Virginia (8 million bushels/year)
Chesapeake Bay Oysters
One panmictic population OR
Isolated, genetically distinct populations?

17. One population, which over time declined to an extent that there are now individual populations that have become genetically isolated?
Retentive/trap-like estuaries with low gene flow among systems?

18. Microsatellites
+High power of discrimination for populations genetics and restoration monitoring
+Highly variable
+High throughput
+Nuclear marker-biparentally inherited
Microsatellite- simple sequence repeats often varying lengths among copies (alleles)
ATCTATATATATATATATATATATCGTGG
TCGATATATATATATATATATATAGCACC
Chromosome (allele) from ♀ (TA)10
ATCTATATATATATATATATCGTGG
TCGATATATATATATATATAGCACC
Chromosome (allele) from ♂ (TA)8

19. Populations may be genetically different.
Evidence of Genetic Structure in the Bay using Microsatellite Markers
But Weak Structure
Buroker et al Evidence of differentiation using allozyme markers
Rose, Paynter and Hare J Hered. 97:
Populations may be genetically different.
There is evidence that more distant populations are more distinct.

20. Pairwise Comparisons of 10 Chesapeake Bay Populations
Is structure relevant?
Are populations locally adapted?
4 microsatellite markers
Carlsson et al.

21. What happens to the oysters deployed on reefs?
Molecular markers to track deployed oysters.
Do they reproduce?
Genotype (genetically fingerprint) the spatfall.
Are progeny purebred deployed or wild oysters?
AND/OR
Hybrids?
Do the deployed oysters survive? How long?
Yearly genetic assessments of oysters at experimental deployment sites.
What impact do they have on surrounding populations?
Screening populations-follow through time.

22. Planted hatchery stocks
Wild stocks
Spat population:
Progeny from wild, hatchery or hybrids? Are they more or less fit than wild?
Molecular markers can help us discriminate among stocks/lines and allow us to learn more about the reef recruitment shadow and the results of the inter-breeding of wild and hatchery stocks.

23. Genetic analyses tracking the success of reef stocking
Objective: Monitoring the breeding success, and longer-term relative survivability, of oysters planted on reefs
Experiment designed for the Great Wicomico River system using the genetically unique, disease tolerant aquaculture strains (DEBYs). 7 6 5 4 3 2 1
Spat collected at sample sites every 2 weeks from June -October for genetic typing in the years

24. GWR has been seeded multiple times over the years with several different stocks
-06
Since 2002 primarily DEBY deployments as part of the experimental design to track success of planted oysters.

25. Why did we choose DEBYs for the GWR experiment?
DEBYs are genetically unique. Maternal signal-mtDNA.
DEBYs Show High Frequency of Mitochondrial Haplotypes (DNA fingerprint patterns) that are Rare in Natural Chesapeake Bay Populations
Hinf I digest of mt coIII in DEBY strain A B
Hinf I Digest of mt coIII in a Natural Population
Frequency of the B alleles is relatively low in natural populations: <2%.
Frequency of the B alleles is much higher in the DEBY stock, generally ranging from 25-50% depending on the spawn.

26. Example Rappahannock River, Drumming Ground
Microsatellite markers allow clear discrimination between hatchery lines and natural populations
Deployed spat-on-shell - blue
Rappahannock wild – yellow
Example Rappahannock River, Drumming Ground

27. Have the deployed DEBYs contributed significantly to spat production in GWR?
PRIOR TO DEPLOYMENT
DEPLOYED DEBY
PRODUCED SPAT
Rare BB AA
Mt DNA Analyses
Carlsson et al. Great Wicomico
Hare et al form Great Wicomico River 2002
Mt DNA and microsatellite analyses
1579 spat collected in the summer of 2002
1 individual confidently assigned to DEBY
~10% DEBY/WILD hybrids
Overall, data to date suggest that the DEBY contribution has been low: predation, poor survival and reproduction? Recently there have been much larger deployments with efforts and protecting plants and genetic signal needs to be followed over several years.

28. Genetic Considerations
(Aquaculture)
Aquaculture Development
Which oyster stocks to use? Diploids or triploids?
Special genetic lines might be selected for particular traits of interest.
Maintain genetically healthy lines.
Is there any genetic impact on extant natural populations?
Genetic impact of aquaculture lines on natural populations is a concern in many aquatic systems. Eg. Salmonids
But
Is this a concern for aquaculture development in oysters?

29. Little evidence of genetic impact to date
Analysis of oysters collected near two farms growing DEBYs
Site 1
4 microsatellites
2 mtDNA genes
Over 85% significantly not assigned to DEBY
1 individual assigned to DEBY
Site 2
4 microsatellites
2 mtDNA genes
Over 90% significantly not assigned to DEBY
No individuals assigned to DEBY
1 DEBY (natural collection)

30. There is evidence of reduced genetic variation in hatchery lines of C
There is evidence of reduced genetic variation in hatchery lines of C. virginica
Allelic diversity of microsatellites reduced in DEBYS compared to natural populations
Natural population
DEBY strain

31. Genetic Considerations
(Introduction)
Introduction of a Non-native Oyster
Aquaculture or on bottom fishery?
Which species? Genetic identification needed.
Which stock? Broodstock source?
Oregon strain too genetically bottlenecked?

32. 1995 Virginia House of Delegates Resolution no. 450
“Requesting the Virginia Institute of Marine Science to develop a strategic plan for molluscan shellfish research and begin the process of seeking the necessary approvals for in water testing of non-native oyster species.”
ICES Protocols
The International Council for the Exploration of the Seas (ICES) Code of Practice on Introductions and Transfers of Marine Organisms (ICES, 1994):
“…prior to any introduction a detailed analysis should be conducted on the ecological, genetic and disease relationships of the species in its natural range and environment.”
EIS Currently Being Drafted

33. Genetic Analyses of Crassostrea ariakensis
Objectives:
Inventory of germplasm resources in the species, Crassostrea ariakensis- Correct identification of the species became a large concern.
To examine genetic variation and differentiation (population structure), among natural populations of the C. ariakensis from China, Korea and Japan
To examine genetic variability.
In US hatchery stocks (Oregon Strain)
Compared to wild source populations
Jan Cordes and Jie Xiao
Ximing Guo’s group-Rutgers

34. There is Genetic Variation among Wild C. ariakensis Populations
linkage disequilibrium, and significant deviations from Hardy-Weinberg Equilibrium (HWE)
Sample LD
HW E IR
0 of 6
none KR
1 of 6 YR
3 of 6 DR  IR KR YR DR -
0.022
0.014
0.026
<0.001
0.01*
0.007*
0.025 
Population pairwise Fst (above) and P-values (below). * indicates Non-significant values.

35. Genetic Variation among Wild Populations
Factorial Correspondence Analysis (FCA) by Individuals KR YR DR IR

36. US Hatchery Stocks F1 “Oregon Strain” F1 WCA WC P1
Pacific Northwest, USA
“Oregon Strain”
Japan
TUI
SCA99
SCA00
NCA + F1
Yellow
River
Beihai
China

37. Genetic Variation in Hatchery Stocks vs. Wild PopulationsKR
Factorial Correspondence Analysis (FCA) by Population YR IR DR
TUI
WCA
SCA
NCA

38. Oregon strain is relatively highly inbred
Hatchery Stocks show reduction in genetic diversity compared to wild populations
Oregon strain is relatively highly inbred
Wild Populations
Sample LD
HW E IR
0 of 6
none KR
1 of 6 YR
3 of 6 DR
Allelic richness for four hatchery strains and four wild populations of C. ariakensis. 5 10 15 20 25
TUI
WCA
NCA
SCA IR KR YR DR
CarG110
CarG4-60
Car119-6a
Car11-70
Hatchery Strains
Wild Stocks
Hatchery Stocks
Sample LD
HW E
TUI
1 of 6 4
WCA
3 of 6 2
NCA
5 of 6 1
SCA
0 of 6

39. Acknowledgements US National Sea Grant-ODRP
Elizabeth Francis
Georgeta Constantin
Jie Xiao
Qian Zhang
Gail Scott
Cheryl Morrison
Pat Gaffney
Sharon Furriness
Stan Allen
Roger Mann
Missy Southworth
Juli Harding
Aimim Wang
Dr. Wu
Dr. Ahn
Junya Higano
Francis O’Beirn
Tommy Leggett
Ryan Carnegie
Mark Luckenbach
Ken Paynter
Matt Hare
Don Merritt
Wendi Ribeiro
US National Sea Grant-ODRP
NOAA/NMFS Chesapeake Bay Program Office
Virginia Sea Grant College Program
Chesapeake Bay Foundation
US Army Corps of Engineers

40. Research Assistant Scientists
JAC ARSs
Jan F.A. Cordes Jens A. Carlsson
Research Assistant Scientists