1. The Good, the bad and the ugly of Genetic Engineering

2. Genetic engineering
Scientists change the DNA code of an organism in order to:
Make transgenic organisms
Clone an organism

3. Transgenic Organisms
Organisms which have a gene from another organism in their DNA

4. Practical applications
Plants with “insecticide” genes

5. Practical applications
Cows with extra copies of growth hormones

6. Practical applications
Bacteria that make human insulin protein for diabetics

7. Practical applications?
Cool Glow-in-the-dark Mice!!

8. How? Jelly Fish have a protein called GFP (Green fluorescent protein)
Gives them that “glow”

9. How? So… They must have a gene (DNA) that has the info to make GFP
GFP Protein = glowing jelly fish
mRNA transcribed from GFP Gene
GFP Gene (DNA)
Transcription
Translation

10. How?
What makes us different is What genes we have not how we make the proteins!!!
So all you need to do is give an organism a new gene and it will be able to make the protein!

11. How? Jelly fish nucleus with GFP gene Remove GFP gene
Mouse nucleus without GFP gene
Add GFP gene
Mouse nucleus with GFP gene
GFP protein made
Glowing Mice

12. Insulin made by bacteria
Diabetes: dysfunctional Insulin gene; no or low amounts of insulin protein made
Means we can’t regulate blood sugar levels
we can force bacteria to make insulin for us

13. Insulin made by bacteria
Same process: Tell me how!

14. Find healthy insulin gene in human
Cut it out and insert it in bacteria
Bacteria then MAKE human insulin even though they have no use for it!
We extract the insulin from bacteria and use it in injections

15. Cloning
Creating an organism that is genetically identical to its only parent.

16. Cloning
Mammals usually mix info from two parents
In cloning all the chromosomes of the baby come from 1 parent.

17. Sheep 1
Take 1 body cell (udder)
Extract Nucleus
Sheep 2
Take 1 egg cell
Remove nucleus

18. Inject nucleus into Egg Zap to stimulate cell division
Implant egg into surrogate sheep (sheep 3)

19. Wait for Dolly to be born
Which sheep is Dolly identical to??
Why?
Which sheep have to be female?

20. Snuppy: cloned Afghan Hound

22. Genetic Testing
Checking a fetus to determine if the baby has any disease.
- Cystic fibrosis
- Tay Sach’s Disease
- Down Syndrome

23. Genetic Testing Done BEFORE birth Can detect two kinds of mutations
Chromosomal: easily visible, major mutations
Gene mutations: checking for mutated gene; must know what you are looking for!

24. Amniocentesis

25. Amniocentesis Extracting amniotic fluid from womb
Contains cells from fetus
DNA or protein can be isolated and examined

26. Can check for:
Mutations in certain genes (must be looking for something specific)
Chromosome abnormalities
Abnormal protein levels

27. DNA finger printing Used to compare two people’s DNA
Used in paternity cases
Used for crime scene analysis

28. DNA finger printing

29. DNA finger printing
Based on the idea that EVERYONE’s DNA is unique, like a fingerprint
BUT related individuals will have more similarities

30. How to do a DNA fingerprint
Get a sample of DNA and digest it with restriction enzymes
restriction enzymes cut DNA at specific sequences.
For example: EcoRI cuts DNA every time it sees the sequence GAATTC

31. How to do a DNA fingerprint
If everyone’s DNA is unique, the enzyme will cut each persons DNA differently
Example:
TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA
TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA

32. How to do a DNA fingerprint
Run cut up DNA on through electrophoresis
Click here for animation

33. How to do a DNA fingerprint
Small pieces travel fast and move further down the gel slab.
Large pieces move slower and stay closer to the injection point.