1. Chapter 4 Cellular Metabolism

2. 2 Introduction A.A living cell is the site of enzyme-catalyzed metabolic reactions that maintain life.

3. 3 Metabolic Reactions A. Metabolic reactions are of two types: 1.anabolic reactions, larger molecules are constructed from smaller ones, a process requiring energy. 2.catabolic reactions, larger molecules are broken down, releasing energy. The reactions of metabolism are often reversible.

4. 4 B. Anabolism 1.Anabolism provides the substances needed for growth and repair. 2.These reactions occur by dehydration synthesis, removing a molecule of water to join two smaller molecules.

5. 5 3.Polysaccharides, lipids, and proteins are constructed via dehydration synthesis. a.To form fats, glycerol and fatty acids bond. b.The bond between two amino acids is a peptide bond; two bound amino acids form a dipeptide, while many joined form a polypeptide.

6. 6 Fig04.01 CH 2 OH H H OH O H Monosaccharide  H HO H OH CH 2 OH H H OH O H Monosaccharide H HO H OH CH 2 OH H H OH O H Disaccharide H2OH2O Water  H HO H CH 2 OH H H OH O H H O H Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

7. 7 Fig04.02 HC H Glycerol3 fatty acid molecules  OHHO HCOHHO HC C C C (CH 2 ) 14 CH 3 (CH 2 ) 14 CH 3 (CH 2 ) 14 CH 3 OHHO OH O O C C C(CH 2 ) 14 CH 3 O O O HC H Fat molecule (triglyceride)3 water molecules  HC HCO O O H H2OH2O Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (CH 2 ) 14 CH 3 H2OH2O H2OH2O

8. 8 C.Catabolism 1.Catabolism breaks apart larger molecules into their building blocks. 2.These reactions occur by hydrolysis, wherein a molecule of water is inserted into a polymer which is split into two smaller molecules.

9. 9 Fig04.03 Amino acid N H H CC H R Dipeptide molecule  Peptide bond Amino acid N H H CC H H H R H O N H H CC H R H O N H CCOH R H O O N H H CC H R N H CC R H O O H2OH2O Water Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

10. 10 Control of Metabolic Reactions: A.Enzymes control the rates of all the metabolic reactions of the cell. B.Enzyme Action 1.Enzymes are complex proteins that function to lower the activation energy of a reaction so it may begin and proceed more rapidly. Enzymes are called catalysts.

11. 11 2.Enzymes work in small quantities and are recycled by the cell. 3.Each enzyme is specific, acting on only one kind of substrate. 4.Active sites on the enzyme combine with the substrate and a reaction occurs. 5.The speed of enzymatic reactions depends on the number of enzyme and substrate molecules available.

12. 12 C. Factors That Alter Enzymes 1.Enzymes (proteins) can be denatured by heat, pH extremes, chemicals, electricity, radiation, and by other causes. Enzymes that only become active when they combine with a nonprotein component are cofactors. Small organic cofactors are called coenzymes.

13. Fig04.04 Product molecule Unaltered enzyme molecule Enzyme-substrate complex Active site (a)(b)(c) Substrate molecules Enzyme molecule Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

14. 14 Energy for Metabolic Reactions: A.Energy is the capacity to do work. B.Common forms of energy include heat, light, sound, electrical energy, mechanical energy, and chemical energy.

15. C.Release of Chemical Energy - 1.Release of chemical energy in the cell often occurs through the oxidation of glucose. D.Cellular Respiration consists of 3 reactions: glycolysis, citric acid cycle & electron transport chain 1.ATP a.ATP molecules contain three phosphates in a chain. b.A cell uses ATP for many functions including active transport and synthesis of various compounds.

16. 16 ½ O 2 Fig04.05 1 3 4 2 Glycolysis 2 ATP Glucose High-energy electrons (e – ) 2e – and 2H + 2 ATP H2OH2O Electron transport chain ATP32–34 CO 2 2 Pyruvic acids (Each enters separately) 2 CO 2 Acetyl CoA Citric acid cycle Oxaloacetic acid Glycolysis The 6-carbon sugar glucose is broken down in the cytosol into two 3-carbon pyruvic acid molecules with a net gain of 2 ATP and the release of high-energy electrons. Citric Acid Cycle The 3-carbon pyruvic acids generated by glycolysis enter the mitochondria separately. Each loses a carbon (generating CO 2 ) and is combined with a coenzyme to form a 2-carbon acetyl coenzyme A (acetyl CoA). More high-energy electrons are released. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Cytosol Mitochondrion Electron Transport Chain The high-energy electrons still contain most of the chemical energy of the original glucose molecule. Special carrier molecules bring the high-energy electrons to a series of enzymes that store much of the remaining energy in more ATP molecules. The other products are heat and water. The function of oxygen as the final electron acceptor in this last step is why the overall process is called aerobic respiration. Each acetyl CoA combines with a 4-carbon oxaloacetic acid to form the 6-carbon citric acid, for which the cycle is named. For each citric acid, a series of reactions removes 2 carbons (generating 2 CO 2 ’s), synthesizes 1 ATP, and releases more high-energy electrons. The figure shows 2 ATP, resulting directly from 2 turns of the cycle per glucose molecule that enters glycolysis.

17. 17 c.Energy is stored in the last phosphate bond of ATP. d.Energy is stored while converting ADP to ATP; when energy is released, ATP becomes ADP, ready to be regenerated into ATP.

18. Fig04.06 ATP PPP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

19. Fig04.07 P P ADP ATP Energy transferred from cellular respiration used to reattach phosphate Energy transferred and utilized by metabolic reactions when phosphate bond is broken PPP PP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

20. 20 2.Glycolysis a.The first part of cellular respiration is the splitting of 6-C glucose that occurs through a series of enzyme- catalyzed steps called glycolysis. b.Glycolysis occurs in the cytosol and does not require oxygen (is anaerobic). c.Energy from ATP is used to start the process but there is a net gain of energy as a result.

21. 21 3.Aerobic Respiration 1.Oxygen is needed for aerobic respiration, which occurs within the mitochondria. 2.There is a much greater gain of ATP molecules from aerobic respiration. 3.The final products of glucose oxidation are carbon dioxide, water, and energy.

22. 22 Fig04.09 High-energy electrons Complete oxidation of acetyl coenzyme A to H 2 O and CO 2 produces high-energy electrons, which yield much ATP via the electron transport chain Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high-energy electrons H2OH2O 2e – and 2H + Waste products ½ O 2 –NH 2 CO 2 Citric acid cycle Electron transport chain Amino acids Acetyl coenzyme A Simple sugars (glucose) GlycerolFatty acids Proteins (egg white) Carbohydrates (toast, hash browns) Food Fats (butter) Pyruvic acid ATP Breakdown of large molecules to simple molecules Glycolysis 1 2 3 © Royalty-Free/Corbis Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

23. 23 Metabolic Pathways: A.The enzymes controlling either an anabolic or catabolic sequence of reactions must act in a specific order. B.A sequence of enzyme-controlled reactions is called a metabolic pathway.

24. 24 C.Regulation of Metabolic Pathways 1.The rate of a metabolic pathway is determined by a regulatory enzyme responsible for one of its steps. 2.A rate-limiting enzyme is the first step in a series.

25. 25 DNA(Deoxyribonucleic acid): A.Deoxyribonucleic acid (DNA) contains the genetic code needed for the synthesis of each protein (including enzymes) required by the cell. B.Genetic Information 1.A gene is a portion of a DNA molecule that contains the genetic information for making a single protein. The complete set of instructions is the genome.

26. 26 C. DNA Molecules 1.The nucleotides of DNA form a sugar-phosphate backbone with bases extending into the interior of the DNA molecule. 2.The nucleotides of one DNA strand are compatible to those in the other strand (adenine pairs with thymine; cytosine with guanine) and so exhibit complementary base pairing.

27. 27 3.The DNA molecule twists to form a double helix and may be millions of base pairs long.

28. 28 A T TA T A A Fig04.10 C C A C CG G C G CG CG G G T Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. T A T

29. 29 D. DNA Replication 1.Each new cell must be provided with an exact replica of the parent cell's DNA. 2.DNA replication occurs during interphase. a. The DNA molecule splits. b. Nucleotides form complementary pairs with the original strands. 3.Each new DNA molecule consists of one parental strand and one newly- synthesized strand of DNA.

30. 30 TA AT TA T A AT T A A T Fig04.11 C C AT C CG G C C G C G A A T T CG C AT Newly formed DNA molecules Region of replication Original DNA molecule C G G G G G G GG G CC C C CG Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. T A T A T A A

31. 31 Protein Synthesis: A.The Genetic Code- Instructions for making proteins 1.The genetic code is the correspondence of gene and protein building block sequences.

32. 32 2. Transcription a.RNA molecules are single- stranded and contain ribose rather than deoxyribose, and uracil rather than thymine. b.Messenger RNA (mRNA) molecules are synthesized in the nucleus in a sequence complementary to the DNA template in a process called transcription.

33. 33 3.Translation a.Each amino acid corresponds to a triplet of DNA nucleotides; a triplet of nucleotides in messenger RNA is called a codon. b.Messenger RNA can move out of the nucleus and associate with ribosomes in the cytoplasm where the protein will be constructed in a process called translation.

34. 34 c.In the cytoplasm, a second kind of RNA, called transfer RNA, has a triplet of nucleotides called the anticodon, which is complementary to nucleotides of the messenger RNA codon. d.The ribosome holds the messenger RNA in position while the transfer RNA carries in the correct amino acid in sequence, with anticodons matching up to codons.

35. 35 e.The ribosome contains enzymes needed to join the amino acids together. f.As the amino acids are joined, the new protein molecule into its unique shape.

36. 36 Fig04.13 Messenger RNA 1 DNA information is copied, or transcribed, into mRNA following complementary base pairing 2 mRNA leaves the nucleus and attaches to a ribosome 3 Translation begins as tRNA anticodons recognize complementary mRNA codons, thus bringing the correct amino acids into position on the growing polypeptide chain 4 As the ribosome moves along the mRNA, more amino acids are added 5 At the end of the mRNA, the ribosome releases the new protein 6 tRNA molecules can pick up another molecule of the same amino acid and be reused Amino acids attached to tRNA Polypeptide chain Cytoplasm DNA double helix DNA strands pulled apart TranscriptionTranslation Nucleus Direction of “reading” C Codon 1 Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Codon 7 G G G G G A A A U U C C C C C C G G G A Methionine Glycine Amino acids represented Serine Alanine Threonine Alanine Glycine Direction of “reading” DNA strand Messenger RNA A T A A T T T AT AT AT A AT UA UA UA G C C GC GC GC GC GC G C G G C C GC C G UA CG C G G G G G G G G G G C C C C C C C C C C A A A A A T TA AT AT AT AT CG GC GC GC TA TA TA CG AT GC TA CG TA CG CG GC AT TA CG GC T T G CG CG CG CG CG CG CG G C Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C G U A C G G C G C A T C G G C

37. 37 Fig04.14 Messenger RNA Transfer RNA Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 C U G G Messenger RNA Transfer RNA Next amino acid Ribosome 1 1 2 2 3 3 7 4 4 5 5 67 C C CGU CUGCGU Messenger RNA Transfer RNA Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 Peptide bond CUGCGU CCGCG U 6 Messenger RNA Transfer RNA Next amino acid 1 1 2 2 3 3 4 4 5 5 67 67 UCGGAAAAAAGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU The transfer RNA molecule for the last amino acid added holds the growing polypeptide chain and is attached to its complementary codon on mRNA. A second tRNA binds complementarily to the next codon, and in doing so brings the next amino acid into position on the ribosome. A peptide bond forms, linking the new amino acid to the growing polypeptide chain. The tRNA molecule that brought the last amino acid to the ribosome is released to the cytoplasm, and will be used again. The ribosome moves to a new position at the next codon on mRNA. A new tRNA complementary to the next codon on mRNA brings the next amino acid to be added to the growing polypeptide chain. 2 1 3 4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.