1. Endy, DB May 2005 1 Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror. 1(3):1 (2003)

2. Endy, DB May 2005 2 Application Struggle, Limited Success, Struggle… System?? Devices? Design & Fabrication

3. Endy, DB May 2005 3 Struggle, Success, Predictable Success Systems Parts & Fabrication Design Applications

4. Endy, DB May 2005 4 Decoupling –Rules insulating design process from details of fabrication –Enable parts, device, and system designers to work together –VLSI electronics, 1970s Standardization –Predictable performance –Off-the-shelf –ME, 1800s Abstraction –Insulate relevant characteristics from overwhelming detail –Simple artifacts that can be used in combination –From Physics to EE, 1800s Enabling Biological Engineering

5. Endy, DB May 2005 5 Abstraction Devices Parts Systems

6. Endy, DB May 2005 6 Parts Zif268, Paveltich & Pabo c. 1991

7. Endy, DB May 2005 7 Devices cI-857 O Lac RBS T CI LacI CI

8. Endy, DB May 2005 8 Devices LacI  CI inverter CI LacI

9. Endy, DB May 2005 9 Systems Inverter.2Inverter.3Inverter.1

10. Endy, DB May 2005 10 Interfaces Devices Parts Systems Inv.2Inv.3Inv.1 Zif268, Paveltich & Pabo c. 1991 LacI  CI inverter CI LacI

11. Endy, DB May 2005 11 Parts/Device Interface Devices Parts Zif268, Paveltich & Pabo c. 1991 LacI  CI inverter CI LacI

12. Endy, DB May 2005 12 Stories “In 1910, I was in Mexico, in the state of Yucatan, when an invasion of locusts occured; the Indians reported to me that in a certain place the ground was strewn with the corpses of these insects. I went there and collected sick locusts, easily picked out since their principal symptom was an abundant blackish diarrhoea. This malady had not as yet been described, so I studied it. It was a septicaemia with intestinal symptoms, It was caused by bacteria, the locust coccobacilli, which were present almost in the pure state in the diarrhoeal liquid. I could start epidemics in columns of healthy insects by dusting cultures of the coccobacillus on plants in front of the advancing columns: the insects infected themselves as they devoured the soiled plants… In the course of these researches, at various times I noticed an anomaly, shown by some cultures of the coccocacillus which intrigued me greatly, although in fact the observation was ordinary enough, so banal indeed that many bacteriologists had certainly made it before on a variety of cultures. The anomaly consisted of clear spots, quite circular, two or three millimeters in diameter, speckling the cultures grown on agar.” From The Bacteriophage by Dr. Felix d'Herelle, Science News 14: 44-59 (1949). (Translation by J. L. Crammer)

13. Endy, DB May 2005 13 Parts/Device Interface Devices Parts Zif268, Paveltich & Pabo c. 1991 LacI  CI inverter CI LacI XX A  B inverter B A

14. Endy, DB May 2005 14 Device/System Interface Devices Systems Inv.2Inv.3Inv.1 A  B inverter B A C  D inverter D C E  F inverter F E

15. Endy, DB May 2005 15 Device/System Interface Devices Systems E  FC  DA  B inverter B A C  D inverter D C E  F inverter F E X X X

16. Endy, DB May 2005 16 Device/System Interface Devices Systems E  FC  DA  B inverter B A C  D inverter D C E  F inverter F E A  D X X X

17. Endy, DB May 2005 17 Device/System Interface cI-857 O Lac RBS T cI LacI cI-857 RBS T cI O PoPS in PoPS out LacI cI PoPS out PoPS in

18. Endy, DB May 2005 18 cI RBS T O cI PoPS IN Polymerase Per Second = PoPS! cI RBS T O PoPS OUT

19. Endy, DB May 2005 19 cI RBS T O PoPS OUT PoPS IN cI PoPS OUT PoPS IN Polymerase Per Second = PoPS! INVERTER PoPS OUT PoPS IN PoPS OUT PoPS Source (Any)

20. Endy, DB May 2005 20 Device/System Interface Devices Systems X A  B inverter B A C  D inverter D C E  F inverter F E

21. Endy, DB May 2005 21 Device/System Interface Devices Systems BCA A B C PoPS IN PoPS OUT X

22. Endy, DB May 2005 22 ‘I need a few DNA binding proteins.’ ‘Here’s a set of DNA binding proteins, 1  N, that each recognize a unique cognate DNA site, choose any.’ ‘Get me this DNA.’ ‘Here’s your DNA.’ ‘Can I have three inverters?’ ‘Here’s a set of PDP inverters, 1  N, that each send and receive via a fungible signal carrier, PoPS.’ TAATACGACTCACTATAGGGAGA DNA Zif268, Paveltich & Pabo c. 1991 Parts PoPS NOT.1 PoPS Devices PoPS NOT.2 PoPS NOT.3 PoPS NOT.1 Systems

23. Endy, DB May 2005 23 Device-Level System Diagram

24. Endy, DB May 2005 24 Parts- and Device-Level System Diagram

25. Endy, DB May 2005 25 DNA Layout

26. Endy, DB May 2005 26 Trigger Test Circuit Characterization and Debug

27. Endy, DB May 2005 27 Registry of Standard Biological Parts http://parts.mit.edu/

28. Endy, DB May 2005 28 From: XXXX Subject: Endy Letter Date: January 6, 2005 9:45:17 AM EST To: endy@mit.edu Dr. Endy, I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated… …I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent. -Sincerely, XXXX XXXX High School -Grade 10

29. Endy, DB May 2005 29 Education Driving Research

30. Endy, DB May 2005 30 A Constructive Society

31. Endy, DB May 2005 31 c/o Jeff Tabor UT 2004 SB Competition Team

32. Endy, DB May 2005 32 Photons PoPS Light  PoPS Receiver PoPS  Color Converter BBa_I15010 BBa_R0082 BBa_B0034 BBa_E0033 BBa_B0015 c/o Jeff Tabor UT 2004 SB Competition Team

33. Endy, DB May 2005 33 Lens ripped off of overhead projector Casserole dish Pile of cells/agar Thermostable chassis c/o Jeff Tabor UT 2004 SB Competition Team

34. Endy, DB May 2005 34 c/o Jeff Tabor UT 2004 SB Competition Team