1. Chapter 9
From DNA to Protein

2. 9.1 What Is the Information Carried in DNA?
DNA to RNA
The DNA sequence of a gene encodes (contains instructions for building) an RNA or protein product
Converting the information encoded by a gene into a product starts with transcription (RNA synthesis)
During transcription, enzymes use the gene’s DNA sequence as a template to assemble a strand of RNA

3. DNA to RNA

4. DNA to RNA RNA is composed of a single-strand chain of nucleotides
An RNA nucleotide has three phosphate groups, a sugar, and one of four bases
Unlike DNA, the sugar is a ribose
RNA contains three of the same bases found in DNA (adenine, cytosine, and guanine)
RNA’s fourth base is uracil, not thymine (as found in DNA)

5. Comparison of DNA & RNA DNA Double strand Contains A, T, G, C
Only in nucleus
Sugar is De- Oxyribose
RNA
Single strand
Contains A, U, G, C
Goes from nucleus to ribosome
Sugar is Ribose

6. DNA to RNA Three types of RNA:
Ribosomal RNA (rRNA): the main component of ribosomes, which assemble amino acids into polypeptide chains
Transfer RNA (tRNA): delivers amino acids to a ribosome during protein synthesis
Messenger RNA (mRNA): contains the protein-building message; specifies order of amino acid sequence

7. RNA to Protein
An mRNA’s protein-building message is encoded by sets of three nucleotides
By the process of translation, the protein- building information in an mRNA is decoded (translated) into a sequence of amino acids
Results in a polypeptide chain that twists and folds into a protein

8. RNA to Protein

9. RNA to Protein

10. RNA to Protein
A cell’s DNA sequence contains all the information it needs to make the molecules of life
Each gene encodes an RNA, and RNAs interact to assemble proteins
Proteins assemble lipids and carbohydrates, replicate DNA, make RNA, and perform many other functions that keep the cell alive

11. 9.2 How is RNA Assembled?
The same base-pairing rules for DNA also govern RNA synthesis in transcription
An RNA strand is so similar to a DNA strand that the two can base-pair if their nucleotide sequences are complementary
G pairs with C, and A pairs with U (uracil)

12. How is RNA Assembled?

13. How is RNA Assembled?
During transcription, a strand of DNA acts as a template upon which a complementary strand of RNA is assembled from nucleotides
In contrast with DNA replication, only part of one DNA strand, not the whole molecule, is used as a template for transcription

14. How is RNA Assembled?
Transcription begins when an RNA polymerase and regulatory proteins attach to a DNA site called a promoter
RNA polymerase moves over a gene region and unwinds the double helix a bit so it can “read” the base sequence of the DNA strand
The polymerase joins free RNA nucleotides into a chain (at 3’ end of strand), in the order dictated by that DNA sequence

15. 9.3 What Roles Do mRNA, rRNA, and tRNA Play During Translation?
The messenger: mRNA
Codon: an mRNA nucleotide base triplet that codes for an amino acid (or stop signal)
There are a total of sixty-four mRNA codons that constitute the genetic code
The sequence of bases in a triplet determines which amino acid the codon specifies
Example: UUU codes for the amino acid phenylalanine, and UUA codes for leucine

16. The Messenger: mRNA
Figure 9.6 The genetic code.

17. The Messenger: mRNA
Codons occur one after another along the length of an mRNA
When an mRNA is translated, the order of its codons determines the order of amino acids in the resulting polypeptide

18. The Messenger: mRNA a gene region in DNA transcription mRNA codon
Figure 9.7 Example of the correspondence between DNA, RNA, and protein. A gene region in a strand of chromosomal DNA is transcribed into an mRNA, and the codons of the mRNA specify a chain of amino acids—a protein.
codon
codon
codon
translation
protein

19. The Messenger: mRNA
With a few exceptions, twenty naturally occurring amino acids are encoded by the genetic code
Some amino acids are specified by more than one codon
Example: the amino acid tyrosine is specified by two codons: UAA and UAC

20. The Messenger: mRNA
Some codons signal the beginning and end of a protein-coding sequence
The first AUG in an mRNA: signal to start translation
UAA, UAG, and UGA: signals that stop translation
The genetic code is highly conserved

21. The Translators: rRNA and tRNA
Ribosomes interact with transfer RNAs (tRNAs) to translate the sequence of codons in an mRNA into a polypeptide

22. The Translators: rRNA and tRNA
Each tRNA has two attachment sites:
Anticodon: a triplet of nucleotides that base- pairs with an mRNA codon
The other attachment site binds to an amino acid (as specified by the codon)

23. Transfer RNA (tRNA) Transfer RNA (tRNA):
Acts as a molecular interpreter
Carries amino acids
Matches amino acids with codons in mRNA using anticodons
Student Misconceptions and Concerns
1. Less experienced students are often intensely focused on writing detailed notes. The risk is that they miss the overall patterns and the broader significance of the topics discussed. Consider a gradual approach to the subjects of transcription and translation, beginning quite generally and testing comprehension, before venturing into the finer mechanics of each process.
2. Consider placing on the board the basic content from Figure 10.9, noting the sequence, products, and locations of transcription and translation in eukaryotic cells. This reminder can create a quick concept check for students as they learn additional detail.
3. Mutations are often discussed as part of evolution mechanisms. In this sense, mutations may be considered a part of a positive creative process. The dual nature of mutations, potentially deadly yet potentially innovative, should be clarified.
Teaching Tips
1. It has been said that, everything about an organism is an interaction between the genome and the environment. You might wish to challenge your students to explain the significance and validity of this statement.
2. The authors note that the sequential information in DNA and RNA is analogous to the sequential information in the letters of a sentence. This analogy is also helpful when explaining the impact of insertion or deletion mutations that cause a shift in the reading frame.
3. The transcription of DNA into RNA is like a reporter who transcribes a political speech. In both situations, the language remains the same, although in the case of the reporter, it changes its form from spoken to written.
4. A parallel can be drawn between the discovery in 1799 of the Rosetta stone, which provided the key that enabled scholars to crack the previously indecipherable hieroglyphic code, and the cracking of the genetic code in Consider challenging your students to explain what part of the genetic code is similar to the Rosetta stone. This could be a short in-class activity for small groups.
5. Another advantage to the use of RNA to direct protein synthesis is that the original code (DNA) remains safely within the nucleus, away from the many potentially damaging chemicals in the cytoplasm. This is like making photocopies of important documents for study, keeping the originals safely stored away.
6. The production of proteins is like a machine requiring fuel. The molecular machinery (ribosomes and tRNA) used in many cellular processes also requires an input of energy in the form of ATP.
7. If you were using a train analogy for the assembly of monomers into polymers, at this point the DNA and RNA trains are traded in 3 for 1 for the polypeptide train. Thus, in general, polypeptides have about 1/3 as many monomers as the mRNA that coded for them.
8. After translation is addressed, consider asking your students (working singly or in small groups) to list all of the places where base pairing is used (in the construction of a DNA molecule during DNA replication, in transcription, and during translation when the tRNA attaches).
9. Students might want to think of the A and P sites as stages in an assembly line. The A site is where a new amino acid is brought in, according to the blueprint of the codon on the mRNA. The P site is where the growing product/polypeptide is anchored as it is being built. To help them better remember details of translation, students might think of the letters for the two sites to mean “A” for addition, where an amino acid is added, and ”P” for polypeptide, where the growing polypeptide is located.
10. A simple way to demonstrate the effect of a reading frame shift is to have students compare the following three sentences. The first is a simple sentence. But look what happens when a letter is added (2) or deleted (3). The reading frame, or triplet groupings, are re-formed into nonsense.
(1) The big red pig ate the red rag.
(2) The big res dpi gat eth ere dra g.
(3) The big rep iga tet her edr ag.
11. The authors have noted elsewhere that a random mutation is like a shot in the dark. It is not likely to improve a genome any more than shooting a bullet through the hood of a car is likely to improve engine performance!

24. The Messenger: mRNA
Figure 9.6 The genetic code.

26. The Translators: rRNA and tRNA
During translation, tRNAs deliver amino acids to a ribosome
One after the next in the order specified by the codons in an mRNA
As the amino acids are delivered, the ribosome joins them via peptide bonds into a new polypeptide

27. How Is mRNA Translated Into Protein?
Figure 9.10 Overview of translation. In eukaryotes, RNA transcribed in the nucleus moves into the cytoplasm through nuclear pores. Translation occurs in the cytoplasm. Ribosomes simultaneously translating the same mRNA are called polysomes.

28. 9.5 What Happens After a Gene Becomes Mutated?
Types of mutations:
Base-pair substitution: a single base pair changes
Deletion: one or more nucleotides are lost
Insertion: one or more nucleotides become inserted into DNA

29. What Happens After a Gene Becomes Mutated?
Mutations are relatively uncommon events in a normal cell:
Chromosomes in a diploid human cell consist of about 6.5 billion nucleotides
About 175 nucleotides change during DNA replication
Only about 3 percent of the cell’s DNA encodes protein products
There is a low probability that any of those mutations will be in a protein-coding region

30. What Happens After a Gene Becomes Mutated?
When a mutation does occur in a protein- coding region, the redundancy of the genetic code offers a margin of safety
Example: a mutation that changes a CCC codon to CCG may not have further effects, because both of these codons specify the amino acid serine

31. What Happens After a Gene Becomes Mutated?
Other mutations may change an amino acid in a protein, or result in a premature stop codon that shortens it
Mutations that alter a protein can have drastic effects on an organism

32. What Happens After a Gene Becomes Mutated?
Sickle cell anemia
Occurs because of a base-pair substitution in the beta globin gene of hemoglobin
Causes hemoglobin molecules to clump together
Cause red blood cells to form a crescent (sickle) shape
Sickled cells clog tiny blood vessels, thus disrupting blood circulation throughout the body

33. Nucleotide substitution
Normal hemoglobin DNA
Mutant hemoglobin DNA
mRNA
mRNA
Figure The molecular basis of sickle-cell disease.
Normal hemoglobin
Sickle-cell hemoglobin
Figure 10.21

34. What Happens After a Gene Becomes Mutated?
Figure 9.13 An amino acid substitution results in abnormally shaped red blood cells characteristic of sickle-cell anemia.
A base-pair substitution results in the abnormal beta globin chain of sickle hemoglobin (HbS). The sixth amino acid in such chains is valine, not glutamic acid. The difference causes HbS molecules to form rod-shaped clumps that distort normally round blood cells (red) into sickle shapes (tan).

35. Base substitution mRNA and protein from a normal gene Figure 10.22a
Figure 10.22a Base substitution of mutations and their effects.
Base substitution
Figure 10.22a

36. Nucleotide deletion mRNA and protein from a normal gene Deleted
Figure 10.22b Nucleotide deletion of mutations and their effects.
Nucleotide deletion
Figure 10.22b

37. Nucleotide insertion mRNA and protein from a normal gene Inserted
Figure 10.22c Nucleotide insertion of mutations and their effects.
Nucleotide insertion
Figure 10.22c

38. mRNA and protein from a normal gene
(a) Base substitution
Deleted
Figure Three types of mutations and their effects.
(b) Nucleotide deletion
Inserted
(c) Nucleotide insertion
Figure 10.22

39. Protein Synthesis
DNA: TTTCAGATCAAATGGCCCTCTGTCTAA
DNA: _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
mRNA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
A.A. ____ ____ ____ ____ ____ ____ ____ ____ ____
tRNA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

40. The Messenger: mRNA
Figure 9.6 The genetic code.

41. 10/8 Protein Synthesis 9 10/10 Genes 10 10/15 Mitosis 11 10/17 Meiosis12
10/22
Genotype &
Phenotype 13
10/24
Biotechnology 14
10/29
Exam #2
10/31
Begin Evolution