1. P P.s. tabaci Null P.s. syringae Hrp - (TTSS) mutant HR P.s. syringae >50 pathovars based on host specificity Tobacco Bean Tomato P.s. pv. tabaci P HR HR P.s. pv. syringae HR P HR P.s. pv. tomato HR HR P 30  m P. s. tomato DC3000 model pathogen hosts tomato and Arabidopsis representative stealth parasite Hrp type III secretion system (TTSS) Pseudomonas syringae Tobacco leaves

2. ROBIN BUELL - TIGR ALAN COLLMER Cornell JIM ALFANO - Nebraska XIAOYAN TANG - Kansas ARUN CHATTERJEE - Missouri GREG MARTIN - BTI SANDY LAZAROWITZ - Cornell TERRY DELANEY - Cornell SAM CARTINHOUR DAVID SCHNEIDER CHRIS MEYERS Modeling of virulence gene regulation networks in P. syringae Molecular/cellular determinants of plant- bacterium interactions USDA/ARS Center for Agricultural Bioinformatics Cornell Theory Center NSF PGRP DBI-0077622 Experimental biology Computational biology Functional Genomics of the Interactions of Tomato and Pseudomonas syringae pv tomato DC3000 http://pseudomonas-syringae.org http://monod.cornell.edu

3. 2e - 16 2.6e - 3 ND Effector AvrRps4 Pto 2e - 44 2.5e - 2 ND Effector CorR Pto 2e - 72 6.6e - 2 ND Coronatine biosynthesis regulator 1 Relative to 16S and 23S rRNA genes Virulence-related ORFs newly found by Hidden Markov Model search of P.s. tomato DC3000 genome 48 <1e-4 78 <1e-3 212 <1e-2 Fouts, Abramovitch, Alfano, Baldo, Buell, Cartinhour, Chatterjee, D'Ascenzo, Gwinn, Lazarowitz, Lin, Martin, Rehm, Schneider, van Dijk, Tang, and Collmer. 2002. Proc. Natl. Acad. Sci. USA 99:2275-2280.

4. Genome of P. s. tomato DC3000 Buell et al. 2003. PNAS 100:10181-10186 6.5 Mb 5,763 ORFs 3,797 ORFs also in P.aeruginosa and P. putida 811 unknown ORFs not in P.a. or P.p. 7% of genome mobile genetic elements 298 ORFs implicated in virulence, including 38 confirmed TTSS substrates 19 strong candidates pDC3000A carries at least 4 avr/hop genes

5. The problem of genomewide identification of Hrp effector genes in P. syringae HR avr hrp HR hrp R avr R R HR hrp R Effector candidate  "Hop" Effector candidate  "Avr" -10 -35GGAACTGGCACCGAAACTGAAACCGGAACC TCACNNACCACNNAACACNNACTACNNA # of occurrences 1311145 15811 -35 NNN GGAACC NNNNNNNNNNNNNNNN CCACNNA NNN -10 Most effectors found by avirulence phenotype All known avr genes preceded by "Hrp box" promoters Mutant phenotypes typically weak or lacking Secretion/injection "Hops" testable, but slow No common motifs reported in proteins Disease

6. EEL CEL tRNA leu orf4 orf3 orf2 tnpA orf1 orf8orf1 avrE avrF orf3 orf4 hrpW orf5 orf6 orf7 avrPto avrPtoB hrp gene cluster mini-Tn5gus tagging of genes activated by HrpL alternative sigma factor  hrp hrpL tRNA leu Fouts, Abramovitch, Alfano, Baldo, Buell, Cartinhour, Chatterjee, D'Ascenzo, Gwinn, Lazarowitz, Lin, Martin, Rehm, Schneider, van Dijk, Tang, and Collmer. 2002. Proc. Natl. Acad. Sci. USA 99:2275-2280. EELCEL Hrp Pathogenicity Island

7. a. Position 3 or 4 is I, V, or L, and between this residue and the starting M is a polar, positively charged or P residue b. No MIVLFYW residues appear in position 5. c. No D or E in first 12 residues. d. The first 50 residues are amphipathic, rich in polar amino acids, and never have more than 3 of the MIVLFYW group in a row. e. No C between positions 5 and 50 acedbViolations: none ORF1-'AvrRpt2  ORF2-'AvrRpt2  Tsiamis et al. 2000. EMBO J. 19:3204 The rules successfully predict which unknown ORFs encode effectors Petnicki-Ocwieja, Schneider, Tam, Chancey, Shan, Jamir, Schechter, Buell, Tang, Collmer, and Alfano. 2002. Proc. Natl. Acad. Sci. USA 99:7652-7657.