1. 1 DNA, RNA, and PROTEIN SYNTHESIS

2. 2 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein

3. 3 Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

4. 4 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

5. 5 Nucleic Acids

6. 6 DNA or Protein?  1903, Walter Sutton noted the parallelism between chromosome behavior and Mendel's laws, thus identifying genes with chromosomes and marking the beginning of genetics as a science  However, scientists were NOT sure which one (protein or DNA) was the actual genetic material of the cell

7. 7 DNA!  Frederick Griffith in 1928  Frederick Griffith in 1928 discovered what he called a transforming principle, which led to the direct discovery of how DNA works and the beginning of Molecular Genetics. DNA

8. 8

9. 9 DNA!  It wasn't until 1944 that Griffith's "transforming principle" was identified as DNA by Oswald Theodore Avery, along with coworkers Colin MacLeod and Maclyn McCartyColin MacLeod Maclyn McCarty

10. Protein was finally excluded as the hereditary material following a series of experiments published by Alfred Hershey and Martha Chase in 1952. These experiments involved the T2 bacteriophage, a virus that infects the E. coli bacterium. 10 DNA!

11. 11

12. 12

13. DNA! Rosalind Franklin recorded a x-ray photograph of a DNA molecule that another researcher at King's College, Maurice Wilkins, showed to James Watson and Francis Crick without her knowledge or permission. This image helped Watson and Crick construct a model of DNA, which enabled them to fully understand the molecule's structure.Maurice Wilkins James WatsonFrancis Crick 13

14. 14

15. Watson and Crick constructed a model of DNA, which enabled them to fully understand the molecule's structure. Wilkins, Crick and Watson were awarded a Nobel Prize jointly, some years later, after Franklin's death. proposed the double helix or spiral staircase structure of the DNA molecule in 1953double helixDNA1953 15 DNA!

16. 16 Watson Crick

17. 17 Structure of DNA  DNA is made of subunits called nucleotides  DNA nucleotides are composed of a: 1.phosphate, 2.deoxyribose sugar, and 3.nitrogen-containing base  The 4 bases in DNA are: adenine (A), thymine (T), guanine (G), and cytosine (C)

18. 18 DNA Nucleotide

19. 19 Base Pairing Rule Watson and Crick showed that DNA is a double helixWatson and Crick showed that DNA is a double helix A (adenine) pairs with T (thymine)A (adenine) pairs with T (thymine) C (cytosine) pairs with G (guanine)C (cytosine) pairs with G (guanine)

20. 20 Nitrogen Rings Purines have double rings of carbon- nitrogen (G, A)Purines have double rings of carbon- nitrogen (G, A)

21. Nitrogen Rings Pyrimidines have single carbon- nitrogen rings (C, T)Pyrimidines have single carbon- nitrogen rings (C, T) 21

22. Nitrogen Rings This is called complementary base pairing because a purine is always paired with a pyrimidineThis is called complementary base pairing because a purine is always paired with a pyrimidine 22

23. 23. 5’ to 3’ Sugars When the DNA double helix unwinds, it resembles a ladder When the DNA double helix unwinds, it resembles a ladder The sides of the ladder are the sugar-phosphate backbones The sides of the ladder are the sugar-phosphate backbones The rungs of the ladder are the complementary paired bases The rungs of the ladder are the complementary paired bases The two DNA strands are anti-parallel (they run in opposite directions)

24. 24 Anti- Parallel Strands of DNA Template (top part of DNA) always goes from 5’ to 3’

25. 25 DNA Replication

26. 26 Steps in DNA Replication Occurs when chromosomes duplicate (make copies) – Interphase (S-phase) Occurs when chromosomes duplicate (make copies) – Interphase (S-phase) An exact copy of the DNA is produced with the aid of the enzyme DNA polymerase An exact copy of the DNA is produced with the aid of the enzyme DNA polymerase Hydrogen bonds between bases break and enzymes called helicases “unzip” the molecule Hydrogen bonds between bases break and enzymes called helicases “unzip” the molecule Each old strand of nucleotides serves as a template for each new strand Each old strand of nucleotides serves as a template for each new strand New nucleotides move into complementary positions are joined by DNA polymerase New nucleotides move into complementary positions are joined by DNA polymerase

27. 27 Two New, Identical DNA Strands Result from Replication

28. 28 Another View of Replication

29. 29 RNA

30. 30 RNA Differs from DNA 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded 4.RNA molecule can leave the nucleus DNA is cannot leave the nucleus

31. 31 Structure of RNA

32. 32. Three Types of RNA Messenger RNA (mRNA) carries genetic information to the ribosomesMessenger RNA (mRNA) carries genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

33. 33 Making a Protein

34. 34 Genes & Proteins  A gene is a specific location on a chromosome, consisting of a segment of DNA, that codes for a particular protein.  Genes code for particular proteins that determine specific characteristics  Each chromosome has thousands of genes  Organizms that are similar share many of the same genes

35. 35 Genes & Proteins  When a particular protein is needed the cell must make that protein and DNA is the molecule with the instructions on how to make it  The type of protein produced is determined by the order of bases  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist  Amino acids chains are called polypeptides

36. 36 Two Parts of Protein Synthesis 1.Transcription makes an RNA molecule complementary to a portion of DNA 2.Translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a polypeptide

37. 37 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  But DNA is located in the nucleus and cannot leave however proteins are made at the ribosomes in the cytoplasm  So how does the information DNA has get to the ribosomes

38. 38 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  Each three-letter unit on mRNA is called a codon  Most amino acids have more than one codon!  There are 20 amino acids with a possible 64 different triplets  The code is nearly universal among living organisms

39. 39

40. 40

41. 41 Transcription Translation

42. 42 Overview of Transcription  During transcription in the nucleus, a segment of DNA unwinds and unzips, and the DNA serves as a template for mRNA formation  RNA polymerase joins the RNA nucleotides so that the codons in mRNA are complementary to the triplet code in DNA

43. 43 Steps in Transcription  The transfer of information in the nucleus from a DNA molecule to an RNA molecule  Only 1 DNA strand serves as the template  Starts at promoter DNA (TATA box)  Ends at terminator DNA (stop)  When complete, pre-RNA molecule is released

44. 44 Transcription

45. 45

46. 46 What is the enzyme responsible for the production of the mRNA molecule?

47. 47 RNA Polymerase  Enzyme found in the nucleus  Separates the two DNA strands by breaking the hydrogen bonds between the bases  Then moves along one of the DNA strands and links RNA nucleotides together

48. 48 DNApre-mRNA RNA Polymerase

49. 49 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

50. 50 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

51. 51 Processing Pre-mRNA Also occurs in the nucleusAlso occurs in the nucleus Pre-mRNA made up of segments called introns & exonsPre-mRNA made up of segments called introns & exons Exons code for proteins, while introns do NOT!Exons code for proteins, while introns do NOT! Introns spliced out by splicesome- enzyme and exons re-joinIntrons spliced out by splicesome- enzyme and exons re-join End product is a mature RNA molecule that leaves the nucleus to the cytoplasmEnd product is a mature RNA molecule that leaves the nucleus to the cytoplasm

52. 52 RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

53. 53 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

54. 54 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

55. 55 Transfer RNA (tRNA) Made up of 75 to 80 nucleotides longMade up of 75 to 80 nucleotides long Picks up the appropriate amino acid floating in the cytoplasmPicks up the appropriate amino acid floating in the cytoplasm Transports amino acids to the mRNATransports amino acids to the mRNA Have anticodons that are complementary to mRNA codonsHave anticodons that are complementary to mRNA codons Recognizes the appropriate codons on the mRNA and bonds to them with H-bondsRecognizes the appropriate codons on the mRNA and bonds to them with H-bonds

56. 56 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

57. 57 Ribosomal RNA (rRNA) Made up of rRNA is 100 to 3000 nucleotides longMade up of rRNA is 100 to 3000 nucleotides long Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes

58. 58 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

59. 59 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

60. 60 Translation Synthesis of proteins in the cytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: 1.mRNA (codons) 2.tRNA (anticodons) 3.ribosomes 4.amino acids

61. 61 Translation Three steps:Three steps: 1.initiation: start codon (AUG) 2.elongation: amino acids linked 3.termination: stop codon (UAG, UAA, or UGA). Let’s Make a Protein !

62. 62 mRNA Codons Join the Ribosome P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

63. 63 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

64. 64 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

65. 65 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

66. 66 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

67. 67 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

68. 68 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

69. 69 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

70. 70 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

71. 71 End Product –The Protein! The end products of protein synthesis is a primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bondsA sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

72. 72