1. Electronic Supplementary Material Identification and gene expression profile analysis of a major type of lipoprotein lipase in adult medaka Oryzias latipes Lu Wang, Gen Kaneko, Shin-Ichiro Takahashi, Shugo Watabe, Hideki Ushio Fisheries Science Corresponding author: Gen Kaneko Department of Aquatic Bioscience, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi, Bunkyo, Tokyo 113-8657, Japan Tel: +81-3-5841-5300. Fax: +81-5841-8166 E-mail address: agkaneko@mail.ecc.u-tokyo.ac.jp

2. LPL geneMedaka LPL1Red seabream LPL1Torafugu LPL1Mandarin fish LPLZebrafish LPLGilthead seabream LPLRainbow trout LPLEuropean seabass LPLHouse mouse LPLHuman LPLRed seabream LPL2Torafugu LPL2 Medaka LPL1 85.0 79.486.472.583.873.785.367.466.855.654.0 Red seabream LPL1 85.894.4 72.894.277.491.8 69.0 68.4 57.755.8 TorafuguLPL1 85.870.785.376.286.4 69.3 68.7 57.155.8 Mandarin fish LPL 73.494.176.5 95.3 67.7 58.356.1 Zebrafish LPL 71.678.0 72.8 67.4 68.1 55.954.5 Gilthead seabream LPL 75.891.2 68.4 67.7 57.154.9 Rainbow trout LPL 74.967.4 59.357.8 European seabass LPL 68.768.158.356.1 House mouse LPL 95.962.360.1 Human LPL 62.661.3 Red seabream LPL2 88.9 TorafuguLPL2 ESM Table 1 Amino acid identities (%) of the N-terminal region among LPLs used in the alignments

3. LPL geneMedaka LPL1Red seabream LPL1Torafugu LPL1Mandarin fish LPLZebrafish LPLGilthead seabream LPLRainbow trout LPLEuropean seabass LPLHouse mouse LPLHuman LPLRed seabream LPL2Torafugu LPL2 Medaka LPL1 81.179.281.163.881.766.082.449.351.130.7 Red seabream LPL1 82.690.268.494.867.390.247.849.630.728.8 Torafugu LPL1 84.665.183.270.580.547.048.231.530.2 Mandarin fish LPL 67.889.569.388.242.548.931.429.4 Zebrafish LPL 66.565.169.749.348.932.229.6 Gilthead seabream LPL 66.789.542.543.732.030.1 Rainbow trout LPL 69.350.051.134.631.4 European seabass LPL 47.849.630.128.1 House mouse LPL 86.644.838.8 Human LPL 43.739.3 Red seabream LPL2 83.0 Torafugu LPL2 ESM Table 2 Amino acid identities (%) of the C-terminal region among LPLs used in the alignments

4. ESM Fig. 1 Relative mRNA levels of medaka LPL1 in various tissues determined by quantitative real-time PCR. Elongation factor 1α (EF1α, a) and β-actin (b) genes were used as internal controls. Bars: Mean + standard deviation (n = 10). Gene-specific primers and TaqMan probes designed from the housekeeping genes for the expression analysis: EF1α (Accession number: NM_001104662): Forward primer: CAAGGACGGAAATGCCAGT Reverse primer: TACCGCCGATTTTGTAGACG TaqMan probe: (FAM)-ACCTTCTCGCCCCACCGACAAACCC-(TAMRA) β-actin (Accession number: S74868): Forward primer: CTCCATCGTCCACCGCAA Reverse primer: TGGTCGTCTAGGCCCTG TaqMan probe: (FAM)-CTCCTCCCCAGCCAAACACCCAAC-(TAMRA) ab

5. ESM Fig. 2 Comparison of cycle threshold values of three housekeeping genes in the different tissues of medaka. Bars: Mean + standard deviation (n = 10).