Presentation is loading. Please wait.

Presentation is loading. Please wait.

©2000 Timothy G. Standish Ecclesiastes 3:1 1To every thing there is a season, and a time to every purpose under the heaven:

Published byAlison Bailey Modified over 9 years ago

Similar presentations

Presentation on theme: "©2000 Timothy G. Standish Ecclesiastes 3:1 1To every thing there is a season, and a time to every purpose under the heaven:"— Presentation transcript:

1 ©2000 Timothy G. Standish Ecclesiastes 3:1 1To every thing there is a season, and a time to every purpose under the heaven:

2 ©2000 Timothy G. Standish Controlling Gene Expression: Bacteria Timothy G. Standish, Ph. D.

3 ©2000 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some gene products are needed for the function of all cells all the time. These permanently expressed genes are called constitutive genes. Other gene products are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, bacteria would be wasteful if they made the enzymes necessary to synthesize any given amino acid if that amino acid was readily available to them in their environment

4 ©2000 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes Bacterial genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together

5 ©2000 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose E. coli is unlikely to encounter lactose, so it would be wasteful to produce the proteins needed to metabolize it unless necessary Metabolizing lactose for energy only makes sense when two criteria are met: –Other more readily metabolized sugar (glucose) is unavailable –Lactose is available

6 ©2000 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes: 1 LacZ -  -galactosidase - An enzyme that hydrolizes the bond between galactose and glucose 2 LacY - Codes for a permease that lets lactose across the cell membrane 3 LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain 4 Repressor - A constitutively expressed protein that works with the control region to modulate expression

7 ©2000 Timothy G. Standish  -Galactosidease Lac Z gene product Lactose and  -Galactosidease OH O H 2 COH HO Glucose O O OH HOCH 2 HO Galactose Lactose O-  - D -galactopyranosyl-(1->4)-  - D -glucopyranose H2OH2O

8 ©2000 Timothy G. Standish  -Galactosidease Lac Z gene product Lactose and  -Galactosidease OH O HOCH 2 HO Galactose OH O H 2 COH HO Glucose HO GlucoseGalactose

9 ©2000 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: 1 Promoter –Promoters are specific DNA sequences to which RNA Polymerase binds so that transcription can occur –The lac operon promoter also has a binding site for protein called Catabolite Activator Protein (CAP) 2 Operator –The binding site of the repressor protein –The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

10 ©2000 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose RepressorPromoter LacYLacALacZ Operator CAP Binding RNA Pol. Repressor mRNA Hey man, I’m constitutive Come on, let me through No way Jose!

11 ©2000 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive Lac Repressor X RNA Pol. RNA Pol. Great, I can transcribe! This lactose has bent me out of shape Some transcription occurs, but at a slow rate as efficient transcription requires CAP binding to the promoter

12 ©2000 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose RepressorPromoter LacYLacALacZ Operator CAP Binding CAP cAMP Repressor mRNA Hey man, I’m constitutive Lac Repressor X This lactose has bent me out of shape CAP cAMP Bind to me Polymerase RNA Pol. Yipee…! CAP cAMP RNA Pol. At last we meet CAP my love Genes in the operon are efficiently transcribed Hey CAP, let’s get together

13 ©2000 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present RepressorPromoter LacYLacALacZ Operator CAP Binding CAP cAMP CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. Repressor mRNA Hey man, I’m constitutive Repressor STOP Right there Polymerase Alright, I’m off to the races... Come on, let me through!

14 ©2000 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Trp operon genes encode enzymes involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: –Using a repressor that works in exactly the opposite way from the lac operon repressor –Using a special attenuator sequence

15 ©2000 Timothy G. Standish The Tryptophan Biochemical Pathway O - OOC OH HN H H -2 O 3 P OH H H CH 2 O 5-Phosphoribosyl-  -Pyrophosphate PP i N-(5’- Phosphoribosyl) -anthranilate COO - H CH 2 C HO H O Chorismate - OOC OH -2 O 3 POCH 2 NHNH CHCH CC H OH C H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate NHNH - OOCCH 2 NH 3+ C H Tryptophan H2OH2O Serine Antrhanilate COO - NH 2 Glutamate + Pyruvate Glutamine CO 2 +H 2 O -2 O 3 POCH 2 CHCH CC H OH C H NHNH Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate NHNH Indole Anthranilate synthetase (trpE and D) Anthranilate synthetase N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase Tryptophan synthetase

16 ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Present STOP Right there Polymerase Trp Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. RNA Pol. Foiled Again! Repressor mRNA Hey man, I’m constitutive

17 ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

18 ©2000 Timothy G. StandishAttenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

19 ©2000 Timothy G. Standish 3’ 5’ 3’ Transcription And Translation In Prokaryotes Ribosome 5’ mRNA RNA Pol.

20 ©2000 Timothy G. Standish Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU- UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA- AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGA GCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA- AAA-CCG trpE... Terminator The Trp Leader and Attenuator 4 12 3

21 ©2000 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 4 1 2 3 Terminator hairpin 4 12 3

22 ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Starved For Tryptophan 4 1 2 3 RNA Pol. Ribosome Leader peptide Ribosome stalls over sequence 1 and sequence 2 binds to sequence 3 preventing formation of the 3, 4 hairpin Help, I need Tryptophan

23 ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present 4 12 3 RNA Pol. Ribosome Leader peptide is released Ribosome passes over sequence 1 and onto sequence 2 allowing sequence 3 to form the 3, 4 hairpin

24 ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present RNA Pol. Ribosome The 3, 4 hairpin destabilizes the elongation complex 4 12 3

25 ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present Ribosome RNA Pol. RNA polymerase falls off ending transcription 4 12 3 U-rich region acts as a Rho independent terminator

26 ©2000 Timothy G. Standish

Download ppt "©2000 Timothy G. Standish Ecclesiastes 3:1 1To every thing there is a season, and a time to every purpose under the heaven:"

Similar presentations

The lac operon.

The lac operon.
The need for gene regulation Bacterial genome4,000 genes Human genome100,000 genes Not all expressed at any one time May need very high levels e.g. translation.

The need for gene regulation Bacterial genome4,000 genes Human genome100,000 genes Not all expressed at any one time May need very high levels e.g. translation.
Chapter 18 Regulation of Gene Expression in Prokaryotes

Chapter 18 Regulation of Gene Expression in Prokaryotes
Gene Expression in Prokaryotes. Why regulate gene expression? It takes a lot of energy to make RNA and protein. It takes a lot of energy to make RNA and.

Gene Expression in Prokaryotes. Why regulate gene expression? It takes a lot of energy to make RNA and protein. It takes a lot of energy to make RNA and.
AP Biology 2007-2008 Control of Prokaryotic (Bacterial) Genes.

AP Biology Control of Prokaryotic (Bacterial) Genes.
Ch 18 Gene Regulation. Consider: A multicellular organism (Pliny) Do each of his cells have the same genes? Yes, with an exception: germ cells are haploid.

Ch 18 Gene Regulation. Consider: A multicellular organism (Pliny) Do each of his cells have the same genes? Yes, with an exception: germ cells are haploid.
Regulation of Gene Expression

Regulation of Gene Expression
Summary: When and where do cells have control over which genes are expressed and which proteins are active? Proteins are activated through processing.

Summary: When and where do cells have control over which genes are expressed and which proteins are active? Proteins are activated through processing.
Chapter 17 Regulation of gene expression in bacteria: lac Operon of E. coli trp operon of E. coli.

Chapter 17 Regulation of gene expression in bacteria: lac Operon of E. coli trp operon of E. coli.
Genetic Regulatory Mechanisms

Genetic Regulatory Mechanisms
Enzyme Regulation. Constitutive enzymes –Enzymes needed at the same level all of the time Regulated enzymes –Enzymes needed under some conditions but.

Enzyme Regulation. Constitutive enzymes –Enzymes needed at the same level all of the time Regulated enzymes –Enzymes needed under some conditions but.
Control of Gene Expression in Prokaryotes

Control of Gene Expression in Prokaryotes
Chapter 11 Molecular Mechanisms of Gene regulation Jones and Bartlett Publishers © 2005.

Chapter 11 Molecular Mechanisms of Gene regulation Jones and Bartlett Publishers © 2005.
Announcements 1. Reading Ch. 15: skim btm 425-426 2. Look over problems Ch. 15: 5, 6, 7.

Announcements 1. Reading Ch. 15: skim btm Look over problems Ch. 15: 5, 6, 7.
Chapter 18 Regulation of Gene Expression.

Chapter 18 Regulation of Gene Expression.
To understand the concept of the gene function control. To understand the concept of the gene function control. To describe the operon model of prokaryotic.

To understand the concept of the gene function control. To understand the concept of the gene function control. To describe the operon model of prokaryotic.
The Chapter 15 Homework is due on Wednesday, February 4 th at 11:59 pm.

The Chapter 15 Homework is due on Wednesday, February 4 th at 11:59 pm.
Regulation of gene expression References: 1.Stryer: “Biochemistry”, 5 th Ed. 2.Hames & Hooper: “Instant Notes in Biochemistry”, 2 nd Ed.

Regulation of gene expression References: 1.Stryer: “Biochemistry”, 5 th Ed. 2.Hames & Hooper: “Instant Notes in Biochemistry”, 2 nd Ed.
Bacterial Operons A model of gene expression regulation Ch 18.4.

Bacterial Operons A model of gene expression regulation Ch 18.4.
OPERONS: BACTERIAL GENE CONTROL. OPERONS Bacterial cells A group of genes that work together Illustrate how genes expression (“on”) and repression (“off”)

OPERONS: BACTERIAL GENE CONTROL. OPERONS Bacterial cells A group of genes that work together Illustrate how genes expression (“on”) and repression (“off”)

Similar presentations

Ads by Google