Presentation is loading. Please wait.

Presentation is loading. Please wait.

Winston Retreat June 2006 S. cerevisiae 2.0. Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently.

Similar presentations


Presentation on theme: "Winston Retreat June 2006 S. cerevisiae 2.0. Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently."— Presentation transcript:

1 Winston Retreat June 2006 S. cerevisiae 2.0

2 Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently Try to re-engineer so human use-ableso human read-able

3 Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently Try to re-engineer Of interest to biologists (test models) chemists (atomic control of living systems) technologists (biomaterials, energy, medicine) re-writers so human use-able so human read-able

4 Bacteriophage T7 39,937 base pairs 57 putative RBSs encoding 60 proteins 51 regulatory elements From D. Endy

5 Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio. 166:477 (1983) From D. Endy

6 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <----------------3-------------- From D. Endy

7 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <----------------3-------------- T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------> <---------------3----

8 From S. Kosuri, D. Endy Genome design algorithm T7 39,937 bps 57 putative RBSs encoding 60 proteins 51 regulatory elements T7.1 41,326 bps 73 “parts”

9 http://parts.mit.edu/

10 From D. Endy Wild-Type T7 (T7 + ) Refactor [1-12,179] :T7 +

11 Two yeast rewrites 1. mtDNA re-org 2. SAGA swap 1. = http://www.mbg.cornell.edu/MBG_Faculty_Detail.cfm?id=10 2. = from Suzanne Berger to NAS 05/15/06

12 mtDNA re-org http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779 mt DNA 85,779 bps 8 verified protein encoding genes 24 tRNA genes 2 rRNA genes ~20 nucleic acid processing factors encoded by introns

13 mtDNA re-org http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779 COX1, ATP8, ATP6, COB, OLI1, VAR1, COX2, COX3, 8 proteins (7 for ox phos, 1 mt ribosome) 11 dubious ORFs

14 mtDNA re-org http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779 15S rRNA21S rRNA one Crick tRNA intron encodes I-Sce enzyme

15 mtDNA re-org Design 2.0 8 protein ORFs2 rRNAs25 tRNAs reduces genome by ~ 4.7 kb Design 3.0 might also remove introns reduces genome by ~20.5 kb lose ~20 nucleic acid modifiers might regulate with T7 RNAP instead of RPO41 and MTF1

16 http://images.google.com/imgres?imgurl=http://transplant.sinica.edu.tw/data/pds.jpg&imgrefurl=http://transplant.sinica.edu.tw/data/pds.html&h=323&w=307&sz=33&tbnid=9iaDZP47jhgGYM:&tbnh=114&tbnw=108&hl=en&start=1&prev=/images%3Fq%3DPDS1000/He%26svnum%3D10%26hl%3Den%26lr%3D%26sa%3DN mtDNA re-org Execution 2.0

17 SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

18 SAGA swap essent’l genes? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

19 SAGA swap HAT? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

20 SAGA swap HAT+TBPreg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

21 SAGA swap txn reg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

22 SAGA swap HAT+neighbor? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

23 SAGA swap core subunits? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

24 SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1

25

26 the end “Break something”


Download ppt "Winston Retreat June 2006 S. cerevisiae 2.0. Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently."

Similar presentations


Ads by Google