1. Predicting Lentiviral Vector Safety In Vivo

2. Devise an approach(s) for safe administration of vector Challenges for for clinical testing Principal issues: Recombination and RCL In vitro QA/QC Tremendous advances in vector safety design while retaining efficient gene transfer in vivo. Status of field

3. Emergence of RCL is the Principal Safety Concern (transduction/primary recombination) LTR-gag-pol-env-LTRLTR-gag-pol-LTR env- ? LTRProm.geneLTR  CMVVSV-GpA CMV Gag RRE pA Pol Neither 2nd nor 3rd generation vectors produce RCL in vitro gag/gag-pol-vector (env-minus) recombinants can be produced in primary transduced cells

4. Genetic recombination likely - experience with retrovirus vectors - utilized for reverse transcription underpins generation of RCL/safety Safety Considerations

5. Generation of RCL in vivo in vitro = generation of LTR-gag-pol-env-LTR- like recombinants in vivo = failure in vector safety and/or QC in vitro RCL in vivo RCL X Safety Considerations

6. What Requisite Biosafety Measures QA/QC testing (LV stocks) a. PCR assay b. RCL assay c. Gag-Pol recombinant assay

7. RCL assay Detects replication competent recombinants Not informative of non-RCL recombinants Advantages: Disadvantages: ? Functionality or replication potential of recombinants ? How recombinants will interact with host ? How the host will interact with the recombinants Not predictive against the emergence of RCL in vivo ? Genetic composition of recombinants ? Risk to the treated individual

8. PCR assay Detects vector- and/or packaging-specific DNA Specificity Advantages: Disadvantages: Biologically non-specific

9. Advantages: Enables monitoring of vector stocks for pre-RCR recombinants - Specifically, recombinants with a functional gag-pol coding region Gag-Pol Recombinant Assay Significance:

10. Significance Shows gag-pol-vector recombinants are produced Functional gag-pol is required for the recombinant to generate RCL in vivo Without functional gag-pol (LTR-gag-pol-LTR), RCL cannot be generated in primary transduced cells Thus, in vitro monitoring for functional gag-pol-containing recombinants provides a tangible way to analyze LV stocks in vitro for their potential to generate RCL in vivo Gag-Pol Recombinant Assay

11. RCL? Recombination Recombination in vivo? LTRProm.geneLTR  CMVVSV-GpA CMV Gag RRE pA Pol QC surrogate (gag-pol recombinants) Hypothesis

12. Genetic Recombination Underpins the generation of RCL Approach: Detect Enrich Characterize - genetically - biologically Analysis of Genetic Recombination

13. Ga LTR RRE puroLTR  HeLa-puro Approach for Analyzing Genetic Recombination

14.  Selection and characterization of recombinant-containing cells tat LTR Tat ga LTR RREpuroLTR HeLa-puro  Recombinant LTR ga puromycin Approach for Analyzing Genetic Recombination

15. pol gag CMV RRE pA SIN vector 3rd generation packaging construct Trans-lenti vector SD rev RRE pA gag CMV pro +  CMVRRE  U3 trans -gene RSV ga RU5R State-of-the-Art Vector Components pA vpr LTR INRT RRE

16. Vector Construct Packaging Construct Env Construct Split Function Lentiviral Vector System VSV-G CMV tat SD rev tat RRE poly A gag CMV RT Pro IN LTR Ga RRECMVGFPLTR  poly A

17. 10 7 IU HeLa-Puro Lentiviral Vector tat Transfer - Nevirapine+ Nevirapine MockLentiviral Vector 0 CFU 1000 CFU Puromycin Selection LTR-puro gag pol RRELTR tat Generation of tat-containing recombinants

18. HeLa-Puro LTR-puro Lentiviral Vector gag Transfer - Nevirapine + Nevirapine MockLentiviral Vector 0 CFU 540 CFU Puromycin Selection Infection 10 7 IU gag-pol orf ? gag pol RRELTR gag pol RRELTR Generation of recombinants with functional gag-pol genetic structure pVSV-G ptat/rev

19. Genetic Analysis of Recombinant Proviral DNA PCR.. 2054 bp gag U3RU5 EXPAND

20. 5’ Sequence Analysis of Genetic Recombinants orf (100%) gag RU5

21. U3R … AAUGAAA… AAAAAAAAAAAAAAAAAAAAAA... (47)(53)(63) Packaging construct ru5u3 AAAA (pA signal) Vector cDNA RNA template n Recombination within the Poly(A) Tract of the Packaging Construct mRNA

22. 3’ Sequence Analysis of Genetic Recombinants RRE U3RU5tat/rev Packaging Construct (3’ end)Vector (3’ LTR) pA signal PPT (AAA) 47 AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA ATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 6) (x 1) (AAA) 53 (AAA) 63 (AAA) 45 10832 U3

23. Trans-Lentiviral Vector System Packaging construct Trans-enzyme construct tat rev tat pro gag CMV pA RRE LTR pA vpr RTIN RRE

24. TLV Impairs Gag Transfer/DNA mobilization # colonies 0 HeLa-Puro LTR-puro Puromycin selection ? 10 7 IU Infection gag pro RRELTR Trans-lenti vector does not generate detectable recombinants Block in DNA mobilization due to trans-RT-IN Absence of functional Gag-Pol (RT-IN) blocks mobilization pVSV-G ptat/rev

25. Recombination occurs between the lentiviral packaging construct and gene transfer vector Summary: Analysis of lentiviral vector recombination These particles package mRNA and if pseudotyped, mobilize the mRNA to other target cells where it is reverse transcribed and integrated The expression of the integrated gag and pol gene produces progeny env-deficient recombinant lentivirus particles Integrated recombinants express viral proteins including, Tat, Gag, and the entire Gag-Pol precursor polyprotein

26. Recombination within the mRNA poly(A) tract: confirmed genetic recombination during reverse transcription in the infected cell suggested that removing homologous sequences from the vector and packaging construct may not be sufficient to prevent recombination may represent a mechanism by which genes without homologous sequence can be mobilized, including endogenous genes (Huang et al., Cell: 44:936, 1986; Raines et al., J. Virol. 62:2437, 1988) Summary: Analysis of lentiviral vector recombination

27. gag CMV RRE pA SIN vector 3rd generation packaging construct Trans-lenti +  CMVRRE  U3 trans -gene RSV ga RU5R Tat-Independent Analysis of Genetic Recombination PRRTIN pA LTR RRE vpr RTIN tat rev tat pro gag CMV pA RRE

28. HeLa-tat LTR puro LTR pVSV-G Infection  gag  U3 pol  Recombinant LTR puro LTR  Puromycin selection CMV-tat 10 8 - 3rd gen. 10 8 - 3rd gen/SIN 10 9 - trans-lenti Gag-Pol-Dependent DNA Mobilization Assay ptat/rev

29. trans-lentiSIN + 3rd gen.3rd gen. Gag-Pol Dependent DNA Mobilization 3rd gen., vector 3rd gen., Env

30. The 3rd generation packaging construct and SIN vector generate recombinants with functional gag-pol capable of mobilizing DNA Since a functional gag-pol genetic structure is absolutely required for the generation of RCL, m onitoring vector stocks for the production of env-minus gag-pol-containing recombinants may serve as an in vitro surrogate marker to control against generating RCL in vivo. Separating RT and IN from the packaging construct decreases the frequency of regeneration of a functional gag-pol structure (and DNA mobilization) by at least 2 orders of magnitude Conclusions The trans-lentiviral vector design is particularly amenable for functional gag-pol QC testing

31. Utility of in vitro monitoring for functional gag-pol-containing recombinants to QC against the potential of vector stocks to produce RCL in vivo Theoretical ? Biologically significant ?

32. Gp120-Receptor-Independent Mechanism(s) for HIV-1 Infection Cellular membrane proteins are incorporated into virion during budding (Arthur et al., Science 258:1935, 1992) Interaction between cell-derived membrane protein and receptor on cell surface facilitates initial binding (Wu et al., submitted) The initial binding of HIV to target cells does not require Env- receptor interaction (Mandor et al., J. Virol. 72:3623, 1998; Wu et al., submitted) HIV Env-independent infection of CD4-minus epithelial cells (Duan et al., J. Virol. 74:10994, 2001) Interaction between cell-derived membrane protein and a cellular receptor can support HIV-1 infection (Enders et al., Science 278:1462, 1997; Mebatsion et al., cell 90:841, 1997; Schnell et al., Cell 90:849, 1997)

33. Infection LTR  gag-pol Env-minus virions LTR  gag-pol Each cycle of replication represents an additional opportunity for genetic recombination and the generation of RCL Perpetuate Risk for RCL

34. Env-minus vector CD4-minus 2. cDNA synthesis 4. Infection/proviral formation 3. Entry route Analysis of Env-Minus Vector Infectivity 1. Virion binding

35. HeLa CD4+HeLa CD4- Env+ Env- Attachment Independent of CD4 & gp120

36. Vector DNA Synthesis Independent of gp120-CD4 Receptor-Mediated Entry R-U5 R-gag Infection: 3TC: 293HeLaJC53 -- -- + -- + -- + - ++++++

37. Vector DNA Synthesis in Acidified Endosomes - + Env-Env+ BFLA1: R-U5

38. Analysis of Vector Infectivity in CD4-minus Cells Vector particles HT-1080Tu139 BFLA1+BFLA1 — BFLA1+BFLA1 — HeLa  Env Env VSV-G 7.3x10 3 1.8x10 4 2.4x10 6 4.8x10 2 2.5x10 3 7.7x10 4 2.8x10 3 3.5x10 3 3.3x10 3 5.0x10 3 1.5x10 5 JC53 ND 00

39. Promise of Lentiviral Vectors for Gene Therapy Central Nervous System Disorders Hematopoietic Stem Cells Eye Diseases Proc. Natl. Acad. Sci. 94:10319, 1997 Science 290:767, 2000J. Neurosci. 20:5587, 2000 Science 283:682, 1999Nature 406:82, 2000Stem Cells 18:352, 2000 Nature Medicine 6:652, 2000

40. GFP Expression in Blood Cells 16 Weeks After Stem Cells Transplantation Numbers represent the percentage of cells that were GFP + 10.1%6.5%8.2%13.9% Mononuclear Cells B CellsT Cells Neutrophils & Monocytes 9.6%9.0%8.0%11.9% Vector Trans-lenti Lentiviral

41. Transduction of Neurons In Vivo

42. (Histologic Assessment) Transduction of Retinal Pigment Epithelium

43. Conclusions In vitro monitoring for functional gag-pol-containing recombinants may serve as a surrogate marker to control against the emergence of RCL in vivo The trans-lentiviral vector design splits the gag-pol function and therefore, is particularly well suited for gag-pol QC monitoring The formation of proviral DNA recombinants with a functional gag-pol coding region may increase the risk for RCL

44. In vitro Monitoring to Predict the Potential for Generating RCL in vivo RCL? Recombination in vivo? LTRprom.geneLTR  CMVVSV-GpA CMV Gag RRE pA Pro QC surrogate (gag-pol recombinants) Recombination (LTR-gag-pro-LTR)

45. Acknowledgments John Wakefield Hongmei Liu Lilin Lai Yimin Wang Tranzyme Inc.UAB Jean Bennett U. Penn. Xiaoyun Wu Tim Townes WenYong Chen Lori McMahon

46. Insertional mutagenesis Genetic recombination Unknown pathogenicity or pathogenic potential of recombinant lentiviral vectors (including human and non-human) Quality assurance & quality control (QA/QC) Generation of RCL in vivo * The ability of lentiviral vectors to infect non-dividing cells raises safety issues for which we can not drawl upon prior experience with retroviral vectors Safety Considerations