Download presentation
1
Ch. 12.4 Mutations Section Objectives:
Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms.
2
Mutations Any change in DNA sequence is called a mutation. can be caused by errors in replication, transcription, cell division, or by external agents. If mutation occurs in gametes (sex cells) it will be passed on to offspring may produce a new trait or it may result in a protein that does not work correctly. the mutation results in a protein that is nonfunctional, and the embryo may not survive In some rare cases a gene mutation may have positive effects.
3
Mutations If mutation takes place in a body cell, it is not passed on to organism’s offspring Damage to a gene may impair the function of the cell When that cell divides, the new cells also will have the same mutation Some mutations of DNA in body cells affect genes that control cell division. This can result in the cells growing and dividing rapidly, producing cancer.
4
Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
5
Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!
6
Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN
7
Does this change the protein?
Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
8
Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
9
The code has repeats in it! Does this change the protein?
Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
10
Really destroyed that protein!
Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop
11
Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN
12
Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
13
Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
14
Causes of Mutations sometimes a mistake in base pairing during DNA replication. many mutations are caused by factors in the environment Any agent that can cause a change in DNA is called a mutagen. Mutagens include radiation, chemicals, and even high temperatures
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.