Presentation is loading. Please wait.

Presentation is loading. Please wait.

Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something.

Similar presentations


Presentation on theme: "Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something."— Presentation transcript:

1

2 Today

3 G Protein Coupled Receptors Animals

4 signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something happens plasma membrane cycles something else happens

5 ~ 4 Orthologs > 23 Paralogs Mammals

6 Why Arabidopsis? Why me? Only one prototypical G  protein.

7 Gene Families

8 Why G  ? Why did my collaborators care? Looking for the Auxin Receptor, –auxin is a plant hormone implicated in multiple physiological pathways.

9 G Protein Coupled Receptors Auxin Functions gravitropism/thigmatropism, etc. perception of light general signal transduction embryogenesis development cell growth and differentiation “oncogenesis” etc.

10 Auxin Receptor = G Protein Coupled Receptor? Maybe Reverse Genetics can supply an answer?

11 Homologous Recombination Range Yes... –mice, many well characterized mammalian cells, –bacteria, –yeast, (remember the bar code deletion project), No (maybe)... –C. elegans (no), –Arabidopsis (done once, not repeated), –Drosophila (shown in principle, not repeated often), –the rest?

12 Agrobacterium Plant Cells Nature Ti-Plasmid T-DNA Hormone genes Opines genes Selectable Markers Reporter Genes Genes Lab Out: Ti genes, opine genes, In: DNA of choice. T-DNA

13 from ~500,000 seeds

14 Set-Up DNA Pooling Seeds (9) Seedlings (225) DNA (225) 123456…30 Super Pools (2000) Germinate and grow seeds in liquid culture. Extract DNA, Super Pool DNA, Maintain lines as pools of seed. PCR Screen 60,000 mutants

15 PCR Strategy T-DNA Reaction: Product: T-DNA Reaction: Product:

16

17 T-DNA Insertion Confirmation Blot gel and hybridize with a WT probe. Band isolate and cycle sequence PCR fragment. G wt

18 Sequence T-DNA Insertion Sites T-DNA UnknownGTP GPA1: \\GCAATGTGTTATTAAGTTGTCT --- ATGCTCTC--- GAAAATTTTCGCCACTGGAAAT// GPA2: \\TGTCTAAGCGTCAATTTGTTTA --- GGGCTCTCTCT--- ACCTGCTCAGGAGCACCTTTAC// Sequence using the PCR primer from the T-DNA sequence. T-DNA Reaction: Product:

19 Probability of Finding an Insert in a Specific Gene thousands of inserts p = 1-(1-f) n p = probability of insertion event f = 1-(Genome/Size of Gene) n = number of T-DNA inserts

20 Finding Random Insertion Mutants Use PCR based approach to identify sequence with foreign DNA inserted into genes of interest.

21 Knockology

22 KO G  sub-units binding site. GTP binding sites. Receptor interaction domain. Effector domains.

23 Genotype? wt gpa1 het gpa1 hom gpa2 het gpa2 hom Southern Analysis Genomic DNA, Cut with SpeI, Probe with 3’ GPA. ~ 5 Kb Probe SpeI ~ 11 Kb …not drawn to scale.

24 Transcript? wt truncated Northern Analysis Extract total RNA Use complementary DNA to probe for mRNA

25 Protein? Western Analysis Proteins extracted Antibodies specific to GPA proteins facilitate probing for the presence of the protein. Antibody was raised to the N- terminus of the gene.

26 T-DNA Mutants Genetic Analysis tagged seed line tagged seed line isolate homozygous mutant isolate homozygous mutant backcross to wildtype backcross to wildtype 2x phenotype analysis phenotype analysis tt x TT (wt) Tt (R / D) T-DNA Segregation TTTt tt T t T t F2

27 Genetic Analysis F2 Segregation 1 : 2 : 1 TTTt tt T t T t Not Lethal 1 wt : 2 het TTTt tt T t T t Lethal 1 wt : 1 het TTTt tt T t T t Gametophyte Lethal

28 Arabidopsis Gantlet Project http://thale.biol.wwu.edu/ Seed/seedlin g Mucilage Germination time Cotyledon size Cotyledon shape Cotyledon color Time first true leaves Petiole length Leaf size Leaf shape Leaf color Leaf margins Stem length Stem color Root length Root branching Adventitious roots Root gravity Shoot gravity Etiolated growth De-etiolation Vegetative/Seeds Initial health in soil Leaf Anatomy Time to bolting No. of leaves when bolts Bolt length Bolt gravity Stem color No. of flowers/bolt Flower morphology Anther length Silique length No. of siliques No. of seeds Leaf senescence Stop flowering Silique shattering Seed size Seed shape Seed color Seed wrinkles Physiology/Seedling Hormones: ABA, Auxin, Brassinolide, Cytokinin, GA Calcium, (low w/EGTA) (high) Dimethylglutaric Acid (1) pH 4.0 – 6.0 NaCl Osmoticum (Mannitol, Sorbitol, PEG, Sucrose) Nutrition/Seedling 0.1X MS, +/- Sucrose 0.01X MS, +/- Sucrose Ca SO 4 (0.2 mM) Minimal Media Nutrient Dropouts: Base media (all) minus one:Ca(NO 3 ), K 2 SO 4, MgSO 4, FeEDTA, KH 2 PO 4, H 3 BO 3, MnSO 4, CuSO 4, ZnSO 4, NaMoO Questions Name? Quest? Air-speed velocity of an unladen swallow? How do you spell Guantlet?

29 De-etiolated Plants?

30 De-etiolated Plants? cell size vs. organ size

31 Mitosis? cyc1At-CDB-GUS

32 Overexpression? Transgene: GPA1 driven by an inducible promoter, - dexamethason, In “WT” plants.

33 GPA1 function? BY-2 Cells …over-express GPA1 in cell culture lines, - measure G1 to G2 transitions, - measure cell plate formations.

34 Conclusions GPA1 operates in controlling cell proliferation, probably by modulating G1 control. May be involved in auxin signal reception?

35 something happens MAPK? KO Turns out agb1 (  -sub-unit) phenotype identical to gpa1, …what do you think that means?

36 GPA1 What Else?

37 GPA1, What Else II? Brassinolide Plant Physiol, June 2002, Vol. 129, pp. 897-907 Since 2001

38 > 4 Orthologs > 23 Paralogs Mammals

39 Assman, Science (310), 2005

40

41 FOR WEDNESDAY...


Download ppt "Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something."

Similar presentations


Ads by Google