Presentation is loading. Please wait.

Presentation is loading. Please wait.

Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum.

Similar presentations


Presentation on theme: "Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum."— Presentation transcript:

1 Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum London Jönköping, Sweden October 27-31, 2014

2 Maintenance Funding application Project starts Project ends Development phase No further funding or gap in funding for development ? The ephemeral lifecycle of a projectFunding Opportunities

3 “…telephones do not crash; power supplies do not fluctuate; and clocks do not halt (in general). Similarly, a computational tool (…) must be reliable across time, it must be maintained.” 1 1 Ribes D., Finholt T.A. 2007 Proceedings of the third International Conference on e-Social Science Funding Opportunities

4 Project Infrastructure Discovery Individualistic Ephemeral Optional Risk taking Implementation Communal / agreed Persistent Essential Robust & reliable Adapted from Patterson D. 2013, Tempe, Arizona Transition from Funding Opportunities

5 “An infrastructure must be taken as a process instead of a system.” Shift in the way we approach e-infrastructures and information resources Stable/rigid system Dynamic/open process Outsource to and involve the end user community We need to set up the environment that will enable the community contribution Koerten, H. & van den Besselaar P. 2013. Sustainable Taxonomic Infrastructures: System or Process? Funding Opportunities

6 Why Global names services are yet not an established and widely used service? Over-ambitious and non-stepwise approach Minimum engagement of stakeholders Failed to convince of the value outside the taxonomic domain 1 2 3 The current situation

7 “The Global Names Architecture was developed to help nomenclaturalists, taxonomists and biodiversity informaticians do their jobs better and faster…” http://globalnames.org/background: We need to frame our efforts in the context of existing urgent societal challenges & reveal the universal scientific value of effective name services Need for a cross-domain approach This approach is critical for securing long-term support from external partners Name services will not only benefit taxonomists, will primarily benefit non-taxonomic disciplines

8 New drugs Clinical research Parasites & vectors Epidemiological data Animal experimental data Biodiversity Biogeographical data Ecological traits Invasive species Ecosystem services Provisioning service data Regulating service data Cultural service data Create new knowledge links at large scale Ethnobiology Medicinal properties Technological uses Vernacular name base Omics research Genomics Proteomics Metabolomics Improved productivity

9 Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTA GAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGA TGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGAT GAATGTATTAGCATGGAA Heterotypic synonyms IDs e423b2b9-35b0-4819-8ce9-88e770d368e7

10 Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTA GAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGA TGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGAT GAATGTATTAGCATGGAA Heterotypic synonyms IDs e423b2b9-35b0-4819-8ce9-88e770d368e7 Didymosphenia geminata (Lyngbye) Schmidt 1899

11 Research Data Alliance Opportunities for efficient collaboration Status: Recognised & Endorsed Chairs: Yde de Jong, Nicola Nicolson, Vince Smith, Paul Kirk, Dimitris Koureas Biodiversity Data Integration IG One of 33 Interest groups of RDA Core group created to support the creation of a Working Group on Global Name services Identified the opportunity to work closely together with TDWG – Joint Working Group? Currently 53 members: 80% increase in number of members since last RDA plenary (P4) Case statement to be submitted by Feb 2015

12 European Strategy Forum on Research Infrastructures (ESFRI) In particular the environmental and health and food clusters Clinical research Biodiversity Ecosystem servicesEthnobiology Omics research In fact we need to find communities as stakeholders/beneficiaries across domains Opportunities for efficient collaboration

13 How would tackle urgent societal challenges? How does it fit in the Big Data technical challenges? Who are the direct and subsequent beneficiaries? Who are the stakeholders and their investment in supporting this? A standing programme to enable collaboration and secure long-term funding 1 2 3 4 Funding Opportunities

14 A Minimum Viable Product (MVP) approach – adopt a stepwise strategy 1 Develop a stepwise work programme to achieve the long- term vision Demonstrate impact delivered from every step through lacing together with compelling case studies 2 3 Funding Opportunities An approach to develop a strong funding profile

15 Three routes to choose from: Small or medium sized grants to develop the building blocks of the service US and EU Foundations and Research Council grants 1 50-100k 3 Large grants from regional funding programmes Horizon 2020 2-8m 2 Embed as element in different bigger projects 200-300k Funding Opportunities

16 H2020 pillarExcellent Science H2020 topicCall: H2020-EINFRA-2015-1 | Topic: EINFRA-9-2015 e-Infrastructures for Virtual Research Environments (VRE) Due date2015-01-14 17:00:00 (Brussels local time) Project acronym LinkD Project titleLinking data, services and communities for predictive modelling of the biosphere Indicative requested EC contributionc. € 8 million Duration of project36 months Supporting the development of a MVP through European e-infrastructure projects Funding Opportunities

17 COST Actions [EU] e.g. BioUnify (submitted but unsuccessful) Research Coordination Networks (RCN) [US] Networking platforms Funding Opportunities National funding sources Research councils & foundations

18 Maintenance Funding application Project starts Project ends Development phase Hybrid model Anchoring to core funds + Crowdsourcing to beneficiaries

19 Thank you @dimitriskoureas d.koureas@nhm.ac.uk


Download ppt "Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum."

Similar presentations


Ads by Google