Presentation is loading. Please wait.

Presentation is loading. Please wait.

PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh.

Similar presentations


Presentation on theme: "PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh."— Presentation transcript:

1 PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh

2

3

4 Approximate global distribution of West Nile virus Solomon, T., Brit. Med. J. 326, 865-869 (2003)

5

6 Clinical course of West Nile encephalitis Solomon, T., Brit. Med. J. 326, 865-869 (2003)

7 Replication Note: After you click on the link above, choose USA and click GO https://www1.qiagen.com/GeneGlobe/PathwayView.aspx?pathway ID=472 Vaccine http://www3.niaid.nih.gov/news/newsreleases/2005/wnvgraphic.ht m CDC- West Nile Virus in Farmed Alligators http://www.cdc.gov/ncidod/EID/vol9no7/03-0085.htm Predicting WNV http://earthobservatory.nasa.gov/IOTD/view.php?id=2172 Global Warming May Lead to More West Nile Virus http://www.scientificamerican.com/article.cfm?id=west-nile-virus- global-warming

8 http://www.bioquest.org/bedrock/problem_spaces/wnv/

9 What are our questions?

10 “It’s called West Nile for a reason...”

11

12 > Stork98TTTAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTG TCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGAC TATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATGAATATGGAG GCGG >Goose99TTCAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTC TGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCA TGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATG Malkinson,M., Banet,C., Weisman,Y., Pokamunski S, King,R., Drouet, M.T. and Deubel, V. 2002. Introduction of West Nile virus in the Middle East. Journal Emerging Infect. Dis. 8 (4): 392-397. Banet-Noach, C., Malkinson, M., Brill, A., Samina, I., Yadin, H., Weisman, Y., Pokamunski, S., King, R., Deubel, V. and Stram, Y. 2003. Phylogenetic relationships of West Nile viruses isolated from birds and horses in Israel from 1997 to 2001. Journal Virus Genes 26 (2), 135-141. But where did Israel-98 come from?

13 The stork brought it…


Download ppt "PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh."

Similar presentations


Ads by Google