Presentation is loading. Please wait.

Presentation is loading. Please wait.

DTU - January Hanne Jarmer

Similar presentations


Presentation on theme: "DTU - January Hanne Jarmer"— Presentation transcript:

1 DTU - January 2007 - Hanne Jarmer
Introduction to DNA microarrays DTU - January Hanne Jarmer

2 Microarrays - The Concept
Measure the level of transcript from a very large number of genes in one go RNA CELL

3 Why? RNA

4 gene specific DNA probes
How? gene mRNA gene specific DNA probes labeled target

5 Microarrays - The Technologies
Stanford-type Microarrays High-density

6 Stanford-type Microarrays

7 Stanford-type Microarrays
Coating glass slides Deposition of probes Post-processing Hybridization

8 Spotting - Mechanical deposition of probes

9 16-pin microarrayer

10

11 Microarrayer

12 Stanford microarrays SAMPLE CONTROL mRNA cDNA Cy3-cDNA Cy5-cDNA

13 Affymetrix GeneChip® oligonucleotide array
• 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data K features to play with

14 Photolithography Mask #2 Mask #1
in situ synthesis T A Mask #2 Mask #1 T A Spacers bound to surface with photolabile protection groups

15 Sample Preparation - Eberwine
RNA 42 C 2 h ssDNA + Reverse Transcriptase 70 C 10 min T7 + RNase H + Polymerase 16 C 2 h T7 pol clean up dsDNA dsDNA 37 C 6 h + Biotin-labeled nucleotides aRNA

16 Detection of Biotin (Affymetrix)
Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG biotinylated anti-anti IgG

17 The Affymetrix GeneChip®
A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

18 NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt)
Service: labelling scanning image analysis

19 Photolithography - Micromirrors

20 Analysis of Data Normalization: Linear or non-linear

21 Is it worth it? Known positives versus the total number of significantly affected genes at 5 different cutoffs in the TnrA experiment Number of known positives Qspline normalization Linear normalization Number of significantly affected genes

22 Analysis of Data Normalization: Linear or non-linear Statistical test:
student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principal Component Analysis (PCA) Clustering and visualization

23 Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites, ...

24 Regulatory T Cells and Allergy
Hanne Jarmer (CBS)

25 Type I Hypersensitivity
A normal reaction against parasites Typical allergens: - pollen - penicillin - nuts - milk - bee venom - mold spores

26 Early Last Century Poul Portier and Charles Richet observed:
Portuguese Man of War “Hmm..., maybe we can make a vaccine?”

27 Early last century

28 Immediate Hypersensitivity Richet got the Nobel Prize
Early Last Century 1. time: No reaction 2. time: Got sick  died Immediate Hypersensitivity anaphylaxis Richet got the Nobel Prize

29 The Mechanism

30 The Regulation Several factors are important: - genetics presentation (concentration/mode) - TH1, TH2 and TReg

31 The Regulation TC TH1 TH2 TReg
The Naive T cell will differentiate into different subsets induced by different cytokines Naive T cell Cytokines TH1 TH2 TReg TC

32 The Regulation Naive T cell IL-12 IL-4 IL-10 ? TH1 TReg TH2

33 CD4+ T cells - The normal state
- Keeping the balance TH1 TH2 TReg

34 The allergic state - Out of balance TReg TH1 TH2

35 Three types of TReg cells
CD25 TReg1 TReg2 TReg3 IL-10 TGF- CD25 = IL-2 receptor  (IL2RA)

36 CD25+ TReg cells Low proliferative capacity
Immunoregulatory properties T cell homeostasis Prevents autoimmunity Antigen specific, cell-cell adhesion Induction of tolerance ... but how? Potential use in Immuno Specific Therapy (SIT) - graft tolerance ... or the other way around ... in vaccines or cancer treatment

37 Microarray Project The goal: Investigate the mechanism  find cure for allergy or an effective SIT The plan: Find the responsible genes by the use of carefully designed microarray experiments

38 The Microarray Experiments
Blood from 5 normal and 5 allergic patients normal allergic normal CD4+CD25+ CD4+ allergic 20 microarrays

39 The Microarray Experiments
20 microarrays

40 1 2-way ANOVA 2 Normal Allergic Normal Allergic CD4+CD25+ CD4+CD25+

41 2-way ANOVA

42 The Regulatory T cell signal
Natural Treg cells Nature Immunology  6, (2005) Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self by Shimon Sakaguch

43 Fewer active TReg cells No tolerance
Maybe ... CTLA-4 B7 X APC TReg (TCR MHC-II) Allergic TReg: Less X Fewer active TReg cells No tolerance

44 Thanks to Liu Anting, PhD from ALK ALK-abello
Kristine Dahlin and Thomas Jensen


Download ppt "DTU - January Hanne Jarmer"

Similar presentations


Ads by Google