1. Bioinformatics and Malaria: How can the computer help in vaccine and drug design against Malaria?

2. The worldwide Malaria threat: - 2 billions live at risk of malarial infection - 500 million individuals get infected per year - 2-3 millions die due to P. falciparum infections - Resistance is found against virtually all commercially available drugs - Vectors become resistant against pyrethroids - The only, highly functional vaccine to date is the administration of irradiated sporozoits - BUT, new, very promising drugs are in development (monkey trials/clinical trials)

3. from Good & Doolan 1998 Three different organism interact in malarial infections 2900 Mb 25-30 Mb 280 Mb

4. from Good & Doolan 1998 Differing stages, different target structures

5. Knowing the genomes/transcriptomes of all involved species.... H. sapiensP. falciparumA. gambiae... reveal structures at which an interference can take place, and this is a necessary a “computer job”

6. Part 1: Bioinformatics + drug target finding

7. Acalcidosome Licensed drugs: pyrimethamines Quinine derivates, Artemsisin drugs

8. Known “obvious” drug targets, for which some drugs are already available Olliaro & Yuthavong 2001

9. The DOXP pathway example

11. - In plants, isoprenoid precursors are synthesized via the DOXP pathway (in the chloroplast), in mammalians via the mevalonate pathway (in the cytosol) - Fosmidomycin is a potent inhibitor of the plant DOXP reductoisomerase

12. BLAST and alignment analysis of some DOXP reductase genes identified a candidate P. falciparum sequence Jooma et al. 1999, Science

13. Work hypothesis of Jooma and cols.: - Is the already tested drug (non-toxic in human use) Fosmidomycin active against Malaria blood stages which synthesize a lot of isopentenyl precursors?

14. In vitro cultures of different strains of P. falciparum were effectively inhibited... Jooma et al. 1999, Science

15. ...and mice infected with lethal P. vinckei were cured at very low doses of either Fosmidomycin or its derivate Jooma et al. 1999, Science

16. Advantageous would be the automated identification of all metabolic enzymes in Plasmodium, and the automated assignment of all known inhibitors to these enzymes Pf metabolic enzymes Inhibitor database High-throughput screening

17. Even drugs that block both human and plasmodial enzymes can by considered, if the human enzyme is not active/present in the tissues where the drug is bio-available SAGE/Microarray data bank of human tissues SAGE/Microarray data of blood stage plasmodium Drug data bank

18. Science 295, 15/02/2002, p 1311-15

19. Compounds which are weak inhibitors may be modified by combinatorial chemistry in silico if the target structure (3-dimensional!) is known, minimizing the number of potential test compounds N H C X Y Z Target structure

20. A major drawback of alignment-based drug target search is that some (how many?) enzymes are missed 5´-Taaaccctgaaccctaaaccctaaaccctgaaccctgaaccctaaa ccctgaaccctaaccctgaacccaacccaaaccctaaacctaaaccc taaaccctaaaccctgaaccctaaaccctgaaccctaaaccctaaa ccctaaaaccctaaaccctaaaccctaaaccctgaaccctaaaccc taaaccctaaaccctaaaccctgaaccctaaaccctaaaccctaaa cctaaaccctgaaccctaaaccctaaaccctg 1 ONE BEER FOR THE ONE WHO FINDS TELOMERASE!

21. Hoffman et al., Nature 2002

22. Part 2: Bioinformatics and vaccine research

23. Is a Malaria vaccine feasible? Co 60 Protection

24. What are known candidate structures: - anti-infection: CSP, SSP2, STARP, SALSA - anti-hepatic stages CSP, SSP2, LSA1, LSA3, EXP1, STARP, SALSA - anti-merozoite: MSP1-4, PfEBA-175, DBP(Pv), AMA1 SERA, GLURP,Pf155-RESA, RAP1, RAP2 - anti-IRBC: PfEMP1, RIFIN, Pf322 GPI - anti-infective stages: Pfs25, Pfs28, Pfs45/48, Pfs230

26. Richie and Saul, Nature 2002

27. Rappuoli 2001 Curr. Opin. Microbiol.

28. Rappuoli 2001 Curr. Opin. Microbiol.

29. Suggestion of Hoffmann et al. (Nature Medicine 4, 1998, p 1351-53)

30. In the case of blood stage vaccine candidates: identify expressed genes cDNA, EST data bank

31. 2. Are they surface-expressed (either merozoite or IRBC)? 3. Express as rec. protein or deliver directly as a DNA vaccine in the rodent system 4. Find homologue in P. falciparum/vivax 5. Test efficacy in in vitro reinvasion assays and in the monkey model 6. Volunteer trials

32. Identified antigens must be checked for strain varying polymorphisms, these polymorphism must be represented in a anti-blood stage vaccine Candidate protein X Variants in strains A B C D Protective epitope

33. By genome scanning, many novel candidate protein domains potentially important in cell-cell interaction were found Trends in Parasitology 17 (5), p 297-99

34. - An important antibody target are the erythrocyte surface-exposed antigens PfEMP1 and perhaps RIFIN and STEVOR (P. falciparum) and VIR (P. vivax) DBL  CIDR DBL  DBL  ATS PfEMP1: Highly polymorphic, 50 copies per genome, 1 is expressed per trophozoite stage parasite, mediate cytoadherence which can promote severe disease

36. Step1: Exploring the endless: Sequencing 500 var genes from Amazonian isolates Full length var genes CIDR DBL  DBL  DBL  Patient data (disease severity) “Pathoarray”

37. Step 2: Checking the expressed repertoire against the Pathoarray Patient samples (var - cDNA) Multiplex-PCR with domain-specific/ degenerated oligomixes Definition of “severe” or “non-severe” var domains Patient data (disease severity)

38. Step 3: Checking the immune response: Is there a anti-severe disease response? Patient samples (Plasma) Elisa Anamnestic data Vaccine subunit candidate Peptide array

40. Drawbacks in the genomic approach to vaccines - Some structures may be lost because the prediction program (HexExon, Glimmer M, PHAT) did not recognize the coding region (see drug targets, too) of a potential antigen - What if the highly effective vaccine target is a glycosid rest? --> SEE GPI!!!

41. Further reading: From genomics to vaccines: Malaria as a model system (Nature medicine 4, 1351 f, 1998) Plasmodium, human and Anopheles genomics and Malaria (Nature 415, 702, this nature issue is particularly interesting, 2002) An overview of chemotherapeutic targets for antimalarial drug discovery (Pharmacol. Ther. 81, 91, 1999) Progress and Challenges for Malaria vaccines Nature 415, 694