1. 1 0 3 2 5 6 4 0  1  2  3  4  5  6  0 start & end 3 5 3 3 7 11 3 3 9 3 3

2. Step 1. Hybridization 올리고머 개수 : 7 + 24 + 5 = 36 개 올리고머 양 : 50 pmol T m : vertex : 50~60 ℃ edge : 60~95 ℃ fragment (weight) : -65~80 ℃ 초기온도 100 ℃ 점차적으로 온도를 낮추어 37 ℃ 상온까지 내린다. 0.5 ℃ /0.5 min

3. Step 2. Ligation 효소 : T4 DNA ligase (TaKaRa) 반응액 구성 올리고머 용액 50  l 10X ligation buffer10  l ligase solution 2  l(700 Unit) ddH 2 O toto 100  l 반응 온도 : 16 ℃ 반응 시간 : O/N

4. O0O0 O1O1 O2O2 O3O3 O4O4 O5O5 O6O6 O 2  3 O 3  4 O 1  2 O 0  1 O 4  5 O 5  6 O0O0 O 6  0

5. Step 3. PCR I 와 로 PCR 100 pmol of each primer to a total volume of 60  l processed for 35 cycles at 94 ℃ for 15 s/ at 30 ℃ for 60 s O0O0 O0O0 cycle 1 2~35 36 denaturation (95 ℃ )annealing (53 ℃ )polymerization (72 ℃ ) 5 min 1 min 5 min

6. Step 4. Gel Electrophoresis I 반응에 참여하지 않은 dNTP 등을 제거하기 위해서 전기영동

7. Step 5. Affinity Chromatography Biotin Sterptavidin 5’ ssDNA OiOi 0123456 Biotin Sterptavidin O4O4 magnetic particle 0 01234560

8. 1. O_0 and biotinylated ^O_0 를 primer 로 사용하여 PCR  ssDNA 2. Aaffinity purification with ^O_2, ^O_3, ^O_4, and ^O_5 3. PCR amplification during affinity purification process

9. Obtaining ssDNA 1. PCR 증폭 : O_0 와 biotinylated ^O_0 를 사용하여 PCR 증폭 2. Annealing to streptavidin paramagnetic particles : Incubating in 100  l of 0.5X saline sodium citrate (SSC) for 45 min at RT with constant shaking 3. Washing : washed three times in 200  l of 0.5X SSC 4. Denaturation to ssDNA : Heated to 80 ℃ in 100  l of ddH 2 O for 5 min to denature the bound dsDNA 5. Acquisition of ssDNA :The aqueous phase with single-stranded DNA was retained

10. Aaffinity purification 1. Annealing of probe : 1 nmol of biotinylated ^O_i was annealed to particles 2. Washing Wash three times in 400  l of 0.5  SSC for 45 min at RT with constant shaking 3. Removal of unbound ssDNA Particles were washed four times in 400  l of 0.5  SSC to remove unbound ssDNA and then 4. Denaturation to ssDNA 5. Acquisition of ssDNA

11. Step 6. Gel Electrophoresis/ PCR Affinity purification 에 의해 얻은 solution 을 전기영동한다. 그 중에서 가장 작은 분자량을 가지는 밴드를 잘라서 elution 한다. 다시 PCR 과 전기영동 과정을 반복하면서 purity 를 높인다.

12. Step 7. Sequencing PCR product 를 sequencing 한다. 예상한 sequence 와 동일한지 확인한다.

13. GAGTGGAGAG GTGTCACGTCATGGGGCTTT GTTGCGTCTTGCTACCGGAA CACTTAGGTG CAACGCAGAA GGCGCCGCGGGGCGGCG CTCACCTCTC CCGCGGCGCCCCGCCGC vertex_0 fragment_3vertex_1 edge_01 CCGCGGCGCCCCGCCGC fragment_3 CACAGTGCAG GGCGCCGCGGGGCGGCG CGATGGCCTT edge_12 vertex_2

14. Discussion Negative PCR result Sequence Design : high GC content  possibility in non-specific binding Hybridization : temperature decrease : non-specific binding  nick formation  no ligation rxn Ligation : temperature (16 ℃ vs RT) & incubation time (O/N vs 4 hr) : enzyme unit Solutions Ligation/Hybridization conditions Substrate addition order