1. Annotation of Drosophila primer
GEP Workshop – August 2015
Wilson Leung and Chris Shaffer

2. Outline Overview of the GEP annotation project GEP annotation strategy
Annotation goals
Nomenclature
GEP annotation strategy
Using genomics databases
Interpreting RNA-Seq data
Understanding the phase of splice sites
“Annotation of a Drosophila gene” walkthrough

3. Start codon Coding region Stop codon Splice donor Splice acceptor UTR
AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCTTAAAAAAGAGCAAGAACAGTTTAACCATTGAAAACAAGATTATTCCAATAGCCGTAAGAGTTCATTTAATGACAATGACGATGGCGGCAAAGTCGATGAAGGACTAGTCGGAACTGGAAATAGGAATGCGCCAAAAGCTAGTGCAGCTAAACATCAATTGAAACAAGTTTGTACATCGATGCGCGGAGGCGCTTTTCTCTCAGGATGGCTGGGGATGCCAGCACGTTAATCAGGATACCAATTGAGGAGGTGCCCCAGCTCACCTAGAGCCGGCCAATAAGGACCCATCGGGGGGGCCGCTTATGTGGAAGCCAAACATTAAACCATAGGCAACCGATTTGTGGGAATCGAATTTAAGAAACGGCGGTCAGCCACCCGCTCAACAAGTGCCAAAGCCATCTTGGGGGCATACGCCTTCATCAAATTTGGGCGGAACTTGGGGCGAGGACGATGATGGCGCCGATAGCACCAGCGTTTGGACGGGTCAGTCATTCCACATATGCACAACGTCTGGTGTTGCAGTCGGTGCCATAGCGCCTGGCCGTTGGCGCCGCTGCTGGTCCCTAATGGGGACAGGCTGTTGCTGTTGGTGTTGGAGTCGGAGTTGCCTTAAACTCGACTGGAAATAACAATGCGCCGGCAACAGGAGCCCTGCCTGCCGTGGCTCGTCCGAAATGTGGGGACATCATCCTCAGATTGCTCACAATCATCGGCCGGAATGNTAANGAATTAATCAAATTTTGGCGGACATAATGNGCAGATTCAGA
ACGTATTAACAAAATGGTCGGCCCCGTTGTTAGTGCAACAGGGTCAAATATCGCAAGCTCAAATATTGGCCCAAGCGGTGTTGGTTCCGTATCCGGTAATGTCGGGGCACAATGGGGAGCCACACAGGCCGCGTTGGGGCCCCAAGGTATTTCCAAGCAAATCACTGGATGGGAGGAACCACAATCAGATTCAGAATATTAACAAAATGGTCGGCCCCGTTGTTATGGATAAAAAATTTGTGTCTTCGTACGGAGATTATGTTGTTAATCAATTTTATTAAGATATTTAAATAAATATGTGTACCTTTCACGAGAAATTTGCTTACCTTTTCGACACACACACTTATACAGACAGGTAATAATTACCTTTTGAGCAATTCGATTTTCATAAAATATACCTAAATCGCATCGTC
Start codon
Coding region
Stop codon
Splice donor
Splice acceptor
UTR

4. Annotation: Adding labels to a sequence
Genes: Novel or known genes, pseudogenes
Regulatory elements: Promoters, enhancers, silencers
Non-coding RNA: tRNAs, miRNAs, siRNAs, snoRNAs
Repeats: Transposable elements, simple repeats
Structural: Origins of replication, synteny
Experimental results:
DNase I Hypersensitive sites (DHS)
ChIP-chip and ChIP-Seq datasets (e.g., modENCODE)

5. GEP Drosophila annotation projects
D. melanogaster
D. simulans
D. sechellia
Reference
D. yakuba
D. erecta
Published
D. ficusphila
D. eugracilis
D. biarmipes
Species in the Four Genomes Paper
D. takahashii
D. elegans
D. rhopaloa
Annotation projects for
Fall 2015 / Spring 2016
D. kikkawai
D. bipectinata
Anticipate that we will work on the remaining projects from the D. elegans F element and new projects from the D element this Fall.
D. ananassae
Manuscript in progress
D. pseudoobscura
D. persimilis
New species sequenced by modENCODE
D. willistoni
D. mojavensis
D. virilis
D. grimshawi
Phylogenetic tree produced by Thom Kaufman as part of the modENCODE project

6. Muller element nomenclature
Muller elements
Species A B C D E F
D. simulans X 2L 2R 3L 3R 4
D. sechellia
D. melanogaster
D. yakuba
D. erecta
D. ananassae
XLXR
4L4R
D. pseudoobscura XL 3 XR 2 5
D. persimilis
D. willistoni
D. mojavensis 6
D. virilis
D. grimshawi

7. Gene structure nomenclature
Primary
mRNA
Protein
Gene span
Exons
Exon
UTR’s
UTR
CDS’s
CDS

8. GEP annotation strategy
Technique is optimized for projects with a moderately close, well annotated neighbor species
Example: D. melanogaster
Need to apply different strategies when annotating genes in other species
Examples: corn, parrot

9. GEP annotation goals
Identify and annotate all the genes in your project
For each gene, identify and precisely map (accurate to the base pair) all coding exons (CDS)
Do this for ALL isoform
Annotate the initial transcribed exon and transcription start site (TSS)
Optional curriculum not submitted to GEP
Clustal analysis (protein, promoter regions)
Repeats analysis
Synteny analysis

10. Evidence-based annotation
Human-curated analysis
More accurate than standard ab initio and evidence-based gene finders
Goal: collect, analyze, and synthesize all the available evidence to create the best-supported gene model
Example: , ,

11. Collect, analyze, and synthesize
Genome Browser
Conservation (BLAST searches)
Analyze:
Interpreting Genome Browser evidence tracks
Interpreting BLAST results
Synthesize:
Construct the best-supported gene model based on potentially contradictory evidence

12. Basic annotation workflow
Identify the likely ortholog in D. melanogaster
Observe the gene structure of the ortholog
Map each CDS of ortholog to the project sequence
Use BLASTX to identify conserved region
Note position and reading frame
Use these data to construct a gene model
Use TopHat splice junctions to identify splice site boundaries, or a combination of conservation, splice signals, reading frame
Identify the exact start and stop base position for each CDS
Use the Gene Model Checker to verify the gene model
For each additional isoform, repeat steps 2-5

13. Annotation workflow (graphically)
Contig
Feature
BLASTP search of feature against the D. melanogaster proteins database
D. melanogaster gene model (1 isoform, 5 CDS)
BLASTX search of each D. melanogaster CDS against the contig
Contig
Feature 3
Reading frame
Alignment 2 1 3 1

14. Annotation workflow (graphically)
BLASTX search of each D. melanogaster CDS against the contig
Reading frame 3 1 3 2 1
Alignment
Contig
Identify the exact coordinates of each CDS using the Genome Browser M 3
Reading frame GT 1 AG GT
Bem46
Use the Gene Model Checker to verify the final CDS coordinates
Gene model
1245
1383
1437
1678
1740
2081
2159
2337
2397
2511
, , , ,
Coordinates:

15. Four main web sites used by the GEP annotation strategy
GEP UCSC Genome Browser (
FlyBase (
Tools  Genomic/Map Tools  BLAST
Gene Record Finder (
Projects  Annotation Resources
NCBI BLAST (
BLASTX  select the checkbox:

16. UCSC Genome Browser Provides a graphical view of genomic region
Sequence conservation
Gene and splice site predictions
RNA-Seq data and splice junction predictions
BLAT – BLAST-Like Alignment Tool
Map protein or nucleotide sequence against an assembly
Faster but less sensitive than BLAST
Table Browser
Access raw data used to create the graphical browser

17. Two different versions of the UCSC Genome Browser
Official UCSC Version
Published data, lots of species, whole genomes, used for “Chimp Chunks”
GEP Version
GEP data, parts of genomes, used for annotation of Drosophila species

18. Additional training resources
Training section on the UCSC web site
Training videos, user guides and tutorials
Mailing lists
OpenHelix tutorials and training materials
Pre-recorded tutorials
Reference cards

19. GEP UCSC Genome Browser overview
Genomic sequence
Evidence tracks

20. Control how evidence tracks are displayed on the Genome Browser
Five different display modes:
Hide: track is hidden
Dense: all features appear on a single line
Squish: overlapping features appear on separate lines
Features are half the height compared to full mode
Pack: overlapping features appear on separate lines
Features are the same height as full mode
Full: each feature is displayed on its own line
Set “Base Position” track to “Full” to see the amino acid translations
Some evidence tracks (e.g., RepeatMasker) only have a subset of these display modes

21. FlyBase – Database for the Drosophila research community
Lots of ancillary data for each gene in D. melanogaster
Curation of literature for each gene
Reference D. melanogaster annotations for all other databases
Including NCBI, EBI, and DDBJ
Fast release cycle (6-8 releases per year)

22. Be aware of different annotation releases
D. melanogaster Release 6 genome assembly
First change of the assembly since late 2006
Most modENCODE analysis used the Release 5 assembly
Gene annotations change much more frequently
Use FlyBase as the canonical reference
GEP data freeze:
Update GEP materials before the start of semester
Potential discrepancies in exercise screenshots
Minor differences in search results
Let us know about major errors or discrepancies
Lifted release 5 datasets required by the GEP to release 6

23. Gene Record Finder – Observe the structure of D. melanogaster genes
Retrieve CDS and exon sequences for each gene in D. melanogaster
CDS and exon usage maps for each isoform
List of unique CDS
Optimal for the exon-by-exon annotation strategy

24. Nomenclature for Drosophila genes
Drosophila gene names are case-sensitive
Lowercase initial letter = recessive mutant phenotype
Uppercase initial letter = dominant mutant phenotype
Every D. melanogaster gene has an annotation symbol
Begins with the prefix CG (Computed Gene)
Some genes have a different gene symbol (e.g., mav)
Suffix after the gene symbol denotes different isoforms
mRNA = -R; protein = -P
mav-RA = Transcript for the A isoform of mav
mav-PA = Protein product for the A isoform of mav
ey is the gene symbol, CG1901 is the annotation symbol

25. NCBI – comprehensive database for biomedical and genomics information
One of the most comprehensive genomics database
Quality of GenBank records will vary
PubMed for literature searches
BLAST web service
BLAST search against RefSeq, nr/nt databases
Align two (or more) sequences (bl2seq)

26. Nucleotide -> Protein
Common BLAST programs
Except for BLASTN, all alignments are based on comparisons of protein sequences
Alignment coordinates are relative to the original sequences
Decide which BLAST program to use based on the type of query and subject sequences:
Program
Query
Database (Subject)
BLASTN
Nucleotide
BLASTP
Protein
BLASTX
Nucleotide -> Protein
TBLASTN
TBLASTX

27. Where can I run BLAST? NCBI BLAST web service EBI BLAST web service
EBI BLAST web service
FlyBase BLAST (Drosophila and other insects)

28. Data on the Genome Browser is incomplete
The Genome Browser contains many different evidence tracks:
Sequence similarity to D. melanogaster proteins
RNA-Seq from different developmental stages
Gene and splice site predictions
Sequence alignments of multiple Drosophila species
Annotators still need to identify the ortholog
WARNING! Students often over-interpret the BLASTX alignment track (D. mel Proteins); use with caution

29. Identify ortholog based on BLASTP search of the feature against D
Identify ortholog based on BLASTP search of the feature against D. melanogaster proteins
Large increase in E-value from mav-PA to gbb-PB
Most genes (~90%) remain on the same Muller element across the different Drosophila species
~95% of all genes, ~90% of F element genes remain on the same Muller element

30. Basic biological constraints (inviolate rules*)
Coding regions start with a methionine
Coding regions end with a stop codon
Gene should be on only one strand of DNA
Exons appear in order along the DNA (collinear)
Intron sequences should be at least 40 bp
Intron starts with a GT (or rarely GC)
Intron ends with an AG
Only break these rules if they are found in D. melanogaster or supported by experimental evidence
~1% of the genes in D. melanogaster have a GC donor site
* There are known exceptions to each rule

31. Evidence for gene models (in general order of importance)
Expression data
RNA-Seq, EST, cDNA
Conservation
Sequence similarity to genes in D. melanogaster
Sequence similarity to other Drosophila species (Multiz)
Computational predictions
Gene and splice site predictions
Tie-breakers of last resort
See the “Annotation Instruction Sheet”

32. modENCODE RNA-Seq data
RNA-Seq evidence tracks:
RNA-Seq coverage (read depth)
TopHat splice junction predictions
Assembled transcripts (Cufflinks, Oases)
Positive results very helpful
Negative results less informative
Lack of transcription ≠ no gene
GEP curriculum:
RNA-Seq Primer
Browser-Based Annotation and RNA-Seq Data
modENCODE RNA-Seq data: mixed embryos, adult males, adult females

33. Generating RNA-Seq data (Illumina)
5’ cap
Poly-A tail
Processed mRNA
AAAAAA
RNA fragments
(~250bp)
Library with adapters 5’ 3’
Paired end sequencing 5’ 3’
~125bp
RNA-Seq reads
Reverse
Forward
Wang Z et al. (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10(1):57-63.

34. Use the TopHat splice junction predictions to identify splice sites
5’ cap M *
Poly-A tail
Processed mRNA
AAAAAA
RNA-Seq reads
Contig
Intron
TopHat junctions

35. Use BLASTX to map D. melanogaster CDS onto the contig
Use sequence similarity to infer homology
D. melanogaster is very well annotated
Coding sequences evolve slowly
Exon structure changes very slowly
Change two settings in the “Algorithm parameters” section when using bl2seq
Turn off compositional adjustments
Turn off the low complexity filter

36. Strategies for finding small CDS
Examine RNA-Seq coverage and TopHat junctions
Small CDS is typically part of a larger transcribed exon
Use Query subrange to restrict the search region
Increase the Expect threshold and try again
Keep increasing the Expect threshold until you get matches
Also try decreasing the word size
Use the Small Exon Finder
Minimize changes in CDS size
Available under Projects  Annotation Resources
See the “Annotation Strategy Guide” for details

37. A genomic sequence has 6 different reading frames1 3 2
Frames
Frame: Base to begin translation relative to the first base of the sequence

38. Splice donor and acceptor phases
Phase: Number of bases between the complete codon and the splice site
Donor phase: Number of bases between the end of the last complete codon and the splice donor site (GT/GC)
Acceptor phase: Number of bases between the splice acceptor site (AG) and the start of the first complete codon
Phase is relative to the reading frame of the CDS

39. Phase depends on the reading frame
Splice Acceptor
Phase of acceptor site:
Phase 2 relative to frame +1
Phase 0 relative to frame +2
Phase 1 relative to frame +3

40. Phase of the donor and acceptor sites must be compatible
Extra nucleotides from donor and acceptor phases will form an additional codon
Donor phase + acceptor phase = 0 or 3
CCA
AAT G
CCA
AAT G GT
… … … AG
CTC
GAT TT
CTC
GAT TT
By definition, blastx cannot detect the additional codon that results from donor and acceptor phases
CTC
GAT
GTT
CCA
AAT P N V L D
Translation:

41. Incompatible donor and acceptor phases results in a frame shift
CCA
AAT G GT GT
… … AG TT
CTC
GAT
CCA
AAT
TCG AT
GGT
TTC P N G F S
Translation:
Phase 0 donor is incompatible with phase 2 acceptor; use prior GT, which is a phase 1 donor.

42. Verify the final gene model using the Gene Model Checker
Examine the checklist and explain any errors or warnings in the GEP Annotation Report
View your gene model in the context of the other evidence tracks on the Genome Browser
Examine the dot plot and explain any discrepancies in the GEP Annotation Report
Look for large vertical and horizontal gaps
See the “How to do a quick check of student annotations” document on the GEP web site

43. Questions? http://www.flickr.com/photos/jac_opo/240254763/sizes/l/
Introduction to Macs, Annotation of a Drosophila gene walkthrough