1. Forensic DNA Analysis Yuzhen Gao University of Soochow University yuzhengao@suda.edu.cn

2. Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA and Statistics

3. What is DNA?

4. What does DNA stand for? What does DNA do? DNA contains genetic information. DNA codes for the proteins our bodies make that are necessary for survival. Deoxyribose Nucleic Acid or Deoxyribonucleic Acid

5. What is DNA? DNA is a code for making proteins AGC TAG CTT ATA CTC TAT CTC TTT Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid The order of amino acids determines what type of protein is made.

6. What is DNA? Some common proteins are: Hemoglobin - carries oxygen from lungs to cells Insulin - regulates metabolism Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy DNA also determines how much of these proteins each cell makes.

7. What is DNA? What does DNA look like? Double Helix Like a Twisted Ladder

8. What is DNA? What does DNA look like? Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs of Ladder)

9. What is DNA? The DNA ladder is made up of building blocks called nucleotides. What is a nucleotide? Phosphate Group Deoxyribose sugar Base Adenine Cytosine Guanine Thymine

10. The 4 Bases A Adenine G Guanine C Cytosine T Thymine

11. The 4 Bases G C T A

12. A pairs with T G pairs with C The bases pair up to form the rungs of the ladder.

13. What is DNA? DNA is written as the sequence of these bases: AAGTCGATCGATCATCGATCATACGT In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell. Only one side of the ladder is written.

14. What is DNA? Among humans, most of the 3 billion bases in the DNA sequence are exactly the same. Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another. Human DNA is even 98% similar to chimpanzees. NO TWO PEOPLE HAVE IDENTICAL DNA* *except identical twins

15. What is DNA? Stupid Facts: If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference. If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide. If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).

16. Where is DNA?

17. DNA is found in the cells in our body. Nucleus (Brain of the cell) Mitochondria (more later)

18. Where is DNA? All types of cells in our body contain a copy of the same DNA. Some cells important to forensic science are: White Blood Cell Sperm CellCheek Cell

19. Where is DNA? DNA in the nucleus is packaged into Chromosomes

20. Where is DNA? (one from Mother) (one from Father) Chromosomes come in pairs There are 46 chromosomes in each cell. (23 pairs)

21. Where is DNA? What are sources of DNA at a crime scene? Blood Semen Saliva Tissue Bone Teeth Hair Maggot Crops DNA can be recovered from any substance that contains cells.

22. Maggot Crop

23. How does DNA differ among Humans?

24. How does DNA differ among humans? DNA is a sequence of 4 possible letters GACT Of the 3 billion letters, 99.8% of the sequence in all humans is identical. There are several ways the sequence can be different.

25. How does DNA differ among individuals? 1. One of the bases (letters) can be different. Person 2 AGCTAGATCGTCATTCCGAG Person 1 AGCTAGATCGTTATTCCGAG

26. How does DNA differ among individuals? 2. Bases (letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG

27. How does DNA differ among individuals? 2. Bases (letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG

28. How does DNA differ among individuals? Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 3. Regions of DNA can be repeated a different # of times

29. How does DNA differ among individuals? 3. Regions of DNA can be repeated a different # of times Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 1 2 3 4 5 6 7

30. Forensic DNA Analysis

31. Reading of Chapter 13 Pages 227-237 good Pages 241-243 (mtDNA) good If material is more complicated than what we cover in class, it likely won’t be on a quiz or exam.

32. Forensic DNA Analysis Collection of Evidence Types of Unknown Samples: Blood, Semen, Stains, Saliva Hair, Tissue, Bones, Teeth Types of Known Samples: Blood or buccal swabs from suspect or victim or other known person

33. Forensic DNA Analysis Beware of Contamination Contamination occurs when DNA from another source gets mixed in with the sample being collected. An investigator touches, sneezes, bleeds on a sample. Wear gloves and use disposable instruments Package items separately. Especially, do not mix known samples (from victim or suspect) with unknown samples.

34. Forensic DNA Analysis Packaging Evidence Package each item individually. Put evidence into paper bags, not plastic. Moisture degrades DNA; air dry samples. Keep samples at room temperature and out of sun.

35. Forensic DNA Analysis Brief History of DNA- (1985) Multilocus RFLP Detects VNTRs: Variable Number of Tandem Repeats

36. Forensic DNA Analysis Brief History of DNA(Late 80s, Early 90s) Single locus RFLP D2S44 probe Lanes 6 and 10 match Lanes 8 and 11 match

37. Forensic DNA Analysis Brief History of DNA(Early 90s) PCR Strips (DQ alpha) 6 Alleles: 1.1, 1.2, 1.3 2, 3 or 4 A person can have one or two of these numbers.

38. Forensic DNA Analysis Short Tandem Repeats (STRs) Individual identification possible Samples: Blood stains, semen Mitochondrial DNA Used in cases of severely degraded DNA Individual identification not possible Samples: Bones, hair shafts Two main types of analyses (90s - Present) :

39. Forensic DNA Analysis Short Tandem Repeats (STRs) Currently the most used of all forensic markers Individual identification possible Type of data used in the FBI CODIS database People differ in length at these loci Are located in the nuclear DNA (chromosomes)

40. Forensic DNA Analysis Short Tandem Repeats (STRs) Regions of DNA can be repeated a different # of times Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 6 1 2 3 4 5 1 2 3 4 5 6 7

41. Forensic DNA Analysis Short Tandem Repeats (STRs) Locus or Loci: Refers to the location on the chromosome. Allele: Refers to the type of DNA. For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

42. Forensic DNA Analysis Locus: D5S818 Alleles: 7,9 CCAGATAGATAGATAGATAGATAGATAGATCC Paternal chromosome 5 Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Example

43. Forensic DNA Analysis 13 loci used in CODIS

44. Forensic DNA Analysis Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions)

45. PCR Hood

46. Forensic DNA Analysis Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions)

47. The Thermal Cycler Amplifies DNA

48. Forensic DNA Analysis Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions)

49. FMBio Separates Amplified DNA

50. Forensic DNA Analysis Color image of gel

51. Forensic DNA Analysis Black and white image of STR gel. Samples will have one or two bands at each loci. Gel Electrophoresis

52. ABI 310 Genetic Analyzer Separates Amplified DNA

54. Forensic DNA Analysis Sample will have one or two peaks at each loci. Capillary Electrophoresis

55. Forensic DNA Analysis Compare to a ladder that has all peaks at each loci.

56. Forensic DNA Analysis

57. Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179

58. Forensic DNA Analysis Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179

59. Forensic DNA (mitochondria) Mitochondria - The powerhouse of the cell. Mitochondria Mitochondria have their own DNA

60. Forensic DNA (mitochondria) Mitochondrial DNA Double Helix YES Chromosomes NO Ring of DNA YES

61. Forensic DNA (mitochondria) Mitochondrial DNA Mitochondrial DNA is only 16,569 letters long. There is a 900 base pair region with a 1.7% difference (D loop). (compared to 3 billion in nuclear DNA)

62. Forensic DNA (mitochondria) Nuclear DNA vs. Mitochondrial DNA Double Helix One copy per cell Multiple copies in each mitochondria Multiple mitochondria in each cell One Ring 46 Chromosomes MtDNA used for old or degraded samples

63. Forensic DNA (Mitochondria) For nuclear DNA:Length is measured For mtDNA: Sequence is examined Different colored peaks correspond to a different base

64. Forensic DNA Analysis Basic Steps in Analysis Extraction: Separates DNA from sample Sequencing: Sequence is determined by another reaction and separation of sequenced fragments Amplification or PCR: Amplifies small portion of mtDNA (D loop)

65. Forensic DNA (Mitochondria) DNA Sequences are compared to each other. AGCTAGATCGTTATTCCGAG Hair found on Suspect Victim Conclusion:Hair may have come from the victim.

66. Forensic DNA (Mitochondria) DNA Sequences are compared to each other. AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Hair found on Suspect Victim Conclusion:Hair did not come from the victim

67. Forensic DNA (Mitochondria) AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Cigarette butt at crime scene Suspect #1 Conclusion:Cigarette could be from Suspects #2, #4 or other person with the same sequence. AGCTAGATTGTTATTCCGAG Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG Suspect #4

68. DNA and Statistics The final result is presented as a statistic. Do Say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.” Do not say: “The DNA in the bloodstain is John Doe’s DNA.”

69. DNA and Statistics Where do the statistics come from? First, the frequency of each allele is estimated using data from a population data base. Locus: D5S818 Alleles: 7,9 Allele frequency from database 726% 911%

70. DNA and Statistics Where do the statistics come from? Next, the frequency of the genotype at each locus is calculated. Locus: D5S818 Alleles: 7,9 7,96% Genotype frequency

71. DNA and Statistics For total frequency, multiply all of the frequencies together. D5 = 6% D8 = 12% D18 = 0.5% Total = 0.004%

74. Demonstration Calculating Frequencies