Presentation is loading. Please wait.

Presentation is loading. Please wait.

Human Body Organization

Similar presentations


Presentation on theme: "Human Body Organization"— Presentation transcript:

1 Human Body Organization
Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic

2 Chemical Level Elements Molecules Compounds Macromolecules Ions H C O
NaCl KCl Ions Na+ K+ Cl- Ca++ Mg++ Molecules O2 CO2 C6H12O6 Macromolecules Proteins amino acids Lipids fatty Acids Carbohydrates monosaccharides Nucleic Acids nucleotides

3 Cellular Level Chromatin

4 Tissue Level Epithelial Tissue Connective Tissue Muscular Tissue
Nervous Tissue

5 Organ Level Gastrointestinal Tract 1. Mouth Accessory Structures
2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas

6 Organ System Level

7 Organismic Level Darwin sails around the world
and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments

8 Animal Cell Chromatin

9 DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2.
3. Nitrogenous Base Base Pairs: A – T C – G

10 DNA Organization Chromatin organized: DNA Histones
One Duplicated Chromosome

11 Human Chromosomes A Pair of Duplicated Chromosomes
Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait

12 Understanding the Numbers
1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG genes per chromosome ~25, ,000 genes per human genome

13 DNA Functions Pass on Genetic Material Replication Protein Synthesis
Mitosis Meiosis Protein Synthesis Transcription Translation

14 Mitosis

15 Replication Making an exact copy of DNA
Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

16 Embryongenesis - Week 1 Blastocyst Inner Cell Mass
(Embryonic Stem Cells) Pluripotent Stem Cells

17 Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm
Ectoderm Multipotent Stem Cells

18 Cell Migration Growth Cone

19 Radial Glia Act like scaffolding to assist movement of neurons during
development

20 Differentiation

21 Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization

22 Neurobehavioral Hypothesis
Maternal/Fetal Evidence: extensive maternal bleeding prolonged labor delivery complications low birth weight low head circumference body length:body weight multiparity Anectodal Evidence Dutch births during WWII Season of birth effect higher for winter pregnancies parallel with virus exposure

23 Protein Synthesis Transcription DNA to mRNA Translation
mRNA to Protein

24 From Gene to Protein DNA RNA Protein

25 Genetic Code Codons three base code Code for specific amino acids

26 Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis
Carcinogenesis Mutation is corrected

27 Point Mutation Mutation is not corrected Mutation is corrected

28 Sickle-Cell Anemia Mutation

29 Sickle-Cell Anemia Mutation

30 Two-Hit Hypothesis Born with 2 genes or alleles for any given disease:
one from mom one from dad If one is bad, this increases your chance of getting the disease

31 Cancer in Women

32 Lung Cancer


Download ppt "Human Body Organization"

Similar presentations


Ads by Google