1. Cell cycle regulation of DNMT1 and cancer

2. M M M M M M M M DNMT1 M M M M M M M M G0/G1SG2M DNMT1 transcription Enzymatic activity Steady state mRNA The Genome and Epigenome Must be Faithfully Replicated with Each Cell Cycle

3. Expression of DNMT1 mRNA is regulated with the cell cycle

4. -------------CTTTGTGCATTCTGrattusutr(5072-5093)(5123-5211) ----------------------------------------daniorarioutr(2342-2364) ----------------------------------------chickenutr(4936-4991) AATTTTAA--------------------------------mouseutr(5076-5106)(5194-5233) GATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTAChumanutr(5089-5408) AATTTTAA---TTTTTTATTCTGTATTCTATCAGATCTGCrattusutr(5072-5093)(5123-5211) --------------------------------GTTTTTATdaniorarioutr(2342-2364) ----------------------ACTTTATGTAGTTTTTATchickenutr(4936-4991) --------------------AGACTTGATGTAGTTNTTATmouseutr(5076-5106)(5194-5233) CACTGTATGAGTGGAAATTAAGACTTTAT Arattusutr(5072-5093)(5123-5211) daniorarioutr(2342-2364) chickenutr(4936-4991) mouseutr(5076-5106)(5194-5233) AAAAAAAAAAAAAAAAAAAAAAAAAAhumanutr(5089-5408) rattusutr(5072-5093)(5123-5211) ----------------------------------------daniorarioutr(2342-2364) ---------------------------------------chickenutr(4936-4991) ------------------GTGTAGTACTTTGTGCATTCTGmouseutr(5076-5106)(5194-5233) TGATTTAGTGATCAAATTGTGCAGTACTTTGTGCATTCTGhumanutr(5089-5408) The DNMT1 3’UTR Contains A Highly Conserved Element

5. 5’ 3’ 3’UTR probes / competitors UTR  3’- 158 UTR  3’- 56 UTR  5’- 259 5090-5408 5349-5405 5090-5350 5090-5248 0h 20h serum induced 84 41 32 kDa 0 16 8 2024 36 serum induction (h) competitor: 130 85 43 32 kDa none UTR UTR  3 ’56 UTR  3’ 158 UTR  5’ 259 A Specific Protein (p40) Binds the Conserved Region of the DNMT1 3’UTR in Arrested Cells

6. a aa ‭0.5 1 2 4‬ a a a a ‭‬ DNMT1 3’UTR destabilizes mRNA in arrested cells t1/2=105 min t1/2=58 min 0.01 0.1 1 0100200 300 +serum arrested 56 nt

7. growth arrested serum induced (20h) DNMT1 GFP  DNMT1  UTR DNMT1 UTR 56 0 5 10 15 20 25 30 DNMT1  UTR DNMT1 UTR  56 DNMT1 growth arrested serum induced (20h) Normalized DNMT1 mRNA pAD-DNMT-1 Kan 5350 5408 0 5085 DNMT1 DNMT1-UTR  56 DNMT1  UTR CMV polyA GFP The Highly Conserved Region of the 3’UTR is Required to Downregulate the DNMT1 mRNA in Growth Arrested Cells DNMT1  UTR DNMT1 UTR 56 

8. h-DNMT1 h-DNMT1-  3’UTR NIH 3T3 Deregulated cell cycle expression of DNMT1 leads to cellular transformation

9. The 3’UTR inhibits ectopic expression of DNMT1 at the G0 phase of the cell cycle Ectopic expression of DNMT1 induces entry into the S phase of the cell cycle

10. Mitogenic signals DNMT1 DNA replication Fig. 2 DNA replicationDNA methylation Protection of the DNA methylation pattern

11. Inhibition of DNMT1 by antisense oligonucleotides inhibits Y1 tumor growth in vivo

13. Nancy Detich QiangLi Zhuang Nadia Cervoni Ian Weaver Michael Meany