1. TTGACATACCCGTAAT What would the complementary strand of this DNA molecule read? AACTGTATGGGCATTA

2. ATGACGGTACAAGGACGTACTAACTC CCATCGATCTAGTCTAGGTCTA What is the mRNA transcript for this sequence of DNA? -UACUGCC AUG UUC CUG CAU GAU UGA GGGUAGCUAGAUCAGAUCCAGAU Which proteins would the mRNA code for? - Start – Phen – Leu – Hist – Asp – STOP

3. A change in the genetic material of a cell. Are all mutations a bad thing? No, they can be detrimental, but they can also be positive or neutral (no effect on the organism)

4. Types of mutations Chromosomal - changes in chromosome structure or number of chromosomes Translocation – segment of one chromosome is attached to another one Inversion – segment of a chromosome breaks off, flips over and reattaches Addition or deletion of an entire chromosome caused by Non-disjunction Example: down syndrome (an extra 21 st chromosome)

5. Gene Mutations – chemical changes in the DNA. Substitution – replacement of one nucleotide pair (A,C,T or G) with another. Often time this has no effect. Sometimes this will lead to an improved protein or be detrimental (like sickle cell anemia or cystic fibrosis).

6. What would happen to the translation process if one nucleotide were not transcribed (copied into mRNA) correctly? Give at least three possibilities 1.mRNA would not be translated into a protein because the start codon was affected 2.Too much information got translated because a stop codon was affected 3.There is no effect because the nucleotide was not in between start and stop codons

7. Mutations had no effect on the protein TACAAGGACGTACTAACT AUG UUC CUG CAU GAU UGA Start – Phen – Leu – Hist – Asp – STOP TACAAGGACGTGCTAACT AUG UUC CUG CAC GAU UGA Start – Phen – Leu – Hist – Asp – STOP

8. Insertion and deletions – adding or losing a nucleotide pair. This is more dramatic than a substitution because it usually leads to a frameshift mutation, where the entire gene could be changed.

9. Mutation caused a different protein to be made TACAAGGACGTACTAACT AUG UUC CUG CAU GAU UGA Start – Phen – Leu – Hist – Asp – STOP TACAAGGACGTACCTAACT… AUG UUC CUG CAU GGA UUG A… Start – Phen – Leu – Hist – Gly – Leu…