Download presentation
Presentation is loading. Please wait.
Published byEarl Fitzgerald Modified over 9 years ago
1
Protein Synthesis: Translation
3
The Ribosome: Key Points Consists of 2 subunits Large Subunit (60S) Small Subunit (40S) mRNA is clamped by the subunits
4
http://www-tc.pbs.org/wgbh/nova/photo51/images/pict-2001ribosome.jpg
5
The Ribosome: Key Points Ribosome moves toward the 3’ end of the mRNA (5’ to 3’) direction Reads codons and adds amino acids to a growing polypeptide chain Reading Frame – determines the sequence in which the codons are read
6
CAUGCAUGGCAUC This is what the ribosome sees It reads the mRNA in codons in a 5’ to 3’ direction (the ribosome moves toward the 3’ end of the mRNA molecule) There are three possible “phases” the codons can be read 5’ 3’
7
CAUGCAUGGCAUC There are three possible phases the codons can be read This can lead to three completely different sequences! Thus it is vital that the mRNA is positioned correctly within the ribosome Why? 5’ 3’ Here And here
8
Try This! The following is the sequence of the coding DNA strand in a prokaryote Determine the sequence of the transcribed mRNA Then, using the Genetic Code on p240, determine the polypeptide chain How do you know where to start? 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3’
9
tRNA Delivers the amino acids to the ribosome How does a tRNA know when to join the ribosome?
10
tRNA The anticodons of some tRNAs recognize more than one codon This is possible because the rules for base pairing between the third base of the codon and anticodon are relaxed (called the wobble hypothesis) –At the wobble position, U on the anticodon can bind with A or G in the third position of a codon Why would this be beneficial?
11
The Wobble Hypothesis Ability of tRNA to recognize 2 or 3 different mRNA codons The 3rd base of the tRNA anticodon “wobbles”, meaning that it can hydrogen bond with more than one type of base in the 3rd position of the codon http://www.mun.ca/biology/scarr/MGA2-03-30.jpg
12
After the start codon is recognized (AUG – methionine) the subsequent amino acids are added The ribosome has two sites for tRNA –A site (acceptor) –P site (peptide) The “charged” tRNA carrying the next amino acid in sequence enters the A site Then the ribosome moves to the next codon and the “uncharged” tRNA is moved to the P site (the exception to this rule is the start tRNA with methionine that enters the P site directly) A peptide bond forms between the amino acids and the uncharged tRNA is recycled back to the cytoplasm Elongation (refer to Fig 4 on p252)
13
Translation Elongation tRNA translocates to allow a new tRNA to bind to ribosome- mRNA complex http://library.thinkquest.org/C0123260/basic%20knowledge/images/basic%20knowledge/RNA/translation%20steps.jpg
14
Once the stop codon (UGA, UAG, or UAA) is reached, the ribosome will come to a halt (there are no corresponding tRNA’s) Then, a protein release factor comes in to aid the release of the polypeptide chain from the ribosome Translation of the gene of interest ends Alterations may occur – read p253 Termination (refer to Fig 4 e & f on p252)
17
Homework Read section 5.4 which starts on page 250 On page 254, do questions #1-4,6-9,10
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.