2. CH. 12.3 : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis

3. Genes and Proteins The sequence of nucleotides in DNA contain information. This information is put to work through the production of proteins. Proteins fold into complex, three- dimensional shapes to become key cell structures and regulators of cell functions. Thus, by encoding the instructions for making proteins, DNA controls cells.

4. What are Genes You learned earlier that proteins are polymers of amino acids. The sequence of nucleotides in your DNA is a gene that contains the information for assembling the string of amino acids that make up a single protein. (instructions to make a protein) Proteins control an organism: Enzymes, Steroids, Structural Proteins etc.. Are all made from the sequence of letters in your DNA Proteins are polymers made of amino acid monomers Where are proteins made? Ribosomes!!

5. Cell organization Remember: – DNA is in the nucleus DNA contains genes = instructions for making proteins – Cells want to keep DNA in the nucleus where it is protected “locked in the vault” – How does the code for a protein get to a ribosome if the DNA can’t leave the nucleus?

6. Passing on DNA information: need RNA RNA like DNA, is a nucleic acid RNA structure differs from DNA structure in three ways. – 1. Has ribose sugar instead of deoxyribose (DNA) – 2. Replaces thymine (T) with uracil (U) – 3. Single stranded as opposed to double stranded DNA Sugar (ribose) Phosphate group Uracil (U) Nitrogenous base (A, G, C, or U)

7. RNA RNA has a different function than DNA Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. RNA Function: takes from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNA’s assemble the protein.

8. Types of RNA 3 types of RNA 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis (Ribosome). 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time. Has a specific anticodon that is complementary to the sequence on the mRNA.

9. From gene to protein transcription translation protein

10. Protein Synthesis: 2 step process 1. Transcription 2. translation 1.Transcription: DNA -> mRNA In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein

11. Transcription Making mRNA from DNA DNA strand is the template (pattern) – match bases U : A G : C Enzyme – RNA polymerase- splits the DNA, then attaches a complementary strand of RNA. Afterwards the DNA reattaches

12. Matching bases of DNA & RNA Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

13. Matching bases of DNA & RNA Double stranded DNA unzips RNA polymerase attaches at a promoter which is a region of DNA that signals the start of a gene. AGGGGGGTTACACTTTTTCCCCAA

14. Matching bases of DNA & RNA Match complimentary RNA bases to DNA bases on one of the DNA strands (T is replaced with U) U AGGGGGGTTACACTTTTTCCCCAA U G G A A A CC RNA polymerase C C U U U C C C G G G G A A A A A

15. Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

17. RNA Processing Not all the nucleotides in the DNA of eukaryotic cells carry instructions—or code—for making proteins. Genes usually contain many long non-coding nucleotide sequences, called introns, that are scattered among the coding sequences. Regions that contain information are called exons because they are expressed. When mRNA is transcribed from DNA, both introns and exons are copied. The introns must be removed from the mRNA before it can function to make a protein. Enzymes in the nucleus cut out the intron segments and paste the mRNA back together. The mRNA then leaves the nucleus and travels to the ribosome.

18. RNA Processing:simplified Noncoding segments called introns are spliced out ( coding segment = exons)

19. Translation: From mRNA to Protein takes place at the ribosomes in the cytoplasm. Involves 3 types of RNA 1. Messenger RNA (mRNA) =carries the blueprint for construction of a protein 2. Ribosomal RNA (rRNA) = the Ribosome the construction site where the protein is made 3. Transfer RNA (tRNA) = the molecule delivering the proper amino acid to the site at the right time

20. Genetic information written in codons is translated into amino acid sequences Transfer of DNA to mRNA uses “language” of nucleotides – Letters: nitrogen bases of nucleotides (A,T,G,C) – Words: codons : triplets of bases ( ex. AGC)- groups of 3 – Sentences: polypeptide chain – The codons in a gene specify the amino acid sequence of a polypeptide

21. The Genetic Code The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. Virtually all organisms share the same genetic code

22. Transfer RNA molecules serve as interpreters during translation In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide The process is aided by transfer RNAs Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other – Anticodon base pairs with codon of mRNA

23. How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

24. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala Amino acids/ protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

25. AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets called codons TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon = block of 3 mRNA bases codon

26. For ALL life! – support for a common origin for all life Code has duplicates – several codons for each amino acid – This “wiggle room” is mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The Genetic code

28. How are the codons matched to amino acids? The tRNA molecule has a complementary codon to the mRNA called an anticodon There is a specific tRNA for each amino acid

29. mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

30. From gene to protein Transcription DNA-> RNA Transcription DNA-> RNA Translation RNA-> protein Translation RNA-> protein protein

31. DNA – TAC CAA GGA AGT GCG ATA CAT CGT AGC GGT mRNA- A.A. –