Presentation is loading. Please wait.

Presentation is loading. Please wait.

10.4 Evidence of Evolution Evidence of Evolution.

Similar presentations


Presentation on theme: "10.4 Evidence of Evolution Evidence of Evolution."— Presentation transcript:

1 10.4 Evidence of Evolution Evidence of Evolution

2 10.4 Evidence of Evolution The Fossil Record Comparing fossils with living organisms reveals a pattern of gradual change from past to present. *We will never find fossils of every species that ever lived.

3 10.4 Evidence of Evolution Biogeography Study of the locations of organisms around the world Ostrich (Africa) Emu (Australia) Rhea (South America)

4 10.4 Evidence of Evolution Movement of land forms can separate a group of organisms into two separate groups

5 10.4 Evidence of Evolution

6 Embryology Scientists compare embryos to look for similar patters and structures

7 10.4 Evidence of Evolution Anatomy Scientists compare body structures of different species –Homologous structures are similar in structure but different in function. –Evidence of a common ancestor

8 10.4 Evidence of Evolution Human hand Bat wing Mole foot Fly wing –Analogous structures are not evidence of a common ancestor. –Analogous structures have a similar function.

9 10.4 Evidence of Evolution Vestigial structures are remnants of organs or structures that had a function in an early ancestor. (Ostrich wings, wisdom teeth, appendix, whale pelvic/leg bones)

10 10.4 Evidence of Evolution Biochemistry Comparing genes between species AGTCCCGTAGGTCGATGTGGGTAAAAGCTTGATCG AGTCCCGTACGTCGATGTGGGTATAAGCTTGATCG

11 10.4 Evidence of Evolution How similar is human DNA to a…? 98% 50%


Download ppt "10.4 Evidence of Evolution Evidence of Evolution."

Similar presentations


Ads by Google