1. Transcription Chapter 8

2. The Problem Information must be transcribed from DNA in order function further. Information must be transcribed from DNA in order function further. REMEMBER: REMEMBER: DNA  RNA  Protein DNA  RNA  Protein

3. Tanscription in Prokaryotes Polymerization catalyzed by RNA polymerase Polymerization catalyzed by RNA polymerase Can initiate synthesis Can initiate synthesis Uses rNTPs Uses rNTPs Requires a template Requires a template Unwinds and rewinds DNA Unwinds and rewinds DNA 4 stages 4 stages Recognition and binding Recognition and binding Initiation Initiation Elongation Elongation Termination and release Termination and release

4. RNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA pol III) 5 subunits, 449 kd (~1/2 size of DNA pol III) Core enzyme Core enzyme 2  subunits---hold enzyme together 2  subunits---hold enzyme together  --- links nucleotides together  --- links nucleotides together  ’---binds templates  ’---binds templates  ---recognition  ---recognition Holoenzyme= Core + sigma Holoenzyme= Core + sigma

5. RNA Polymerase Features Starts at a promoter sequence, ends at termination signal Starts at a promoter sequence, ends at termination signal Proceeds in 5’ to 3’ direction Proceeds in 5’ to 3’ direction Forms a temporary DNA:RNA hybrid Forms a temporary DNA:RNA hybrid Has complete processivity Has complete processivity

6. RNA Polymerase X-ray studies reveal a “hand” X-ray studies reveal a “hand” Core enzyme closed Core enzyme closed Holoenzyme open Holoenzyme open Suggested mechanism Suggested mechanism NOTE: when sigma unattached, hand is closed NOTE: when sigma unattached, hand is closed RNA polymerase stays on DNA until termination. RNA polymerase stays on DNA until termination.

7. Recognition Template strand Template strand Coding strand Coding strand Promoters Promoters Binding sites for RNA pol on template strand Binding sites for RNA pol on template strand ~40 bp of specific sequences with a specific order and distance between them. ~40 bp of specific sequences with a specific order and distance between them. Core promoter elements for E. coli Core promoter elements for E. coli -10 box (Pribnow box) -10 box (Pribnow box) -35 box -35 box Numbers refer to distance from transcription start site Numbers refer to distance from transcription start site

8. Template and Coding Strands 5’–TCAGCTCGCTGCTAATGGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ 5’– UCAGCUCGCUGCUAAUGGCC–3’ Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand RNA transcript transcription

9. Typical Prokaryote Promoter Pribnow box located at –10 (6-7bp) Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp) -35 sequence ~(6bp) Consensus sequences: Strongest promoters match consensus Consensus sequences: Strongest promoters match consensus Up mutation: mutation that makes promoter more like consensus Up mutation: mutation that makes promoter more like consensus Down Mutation: virtually any mutation that alters a match with the consensus Down Mutation: virtually any mutation that alters a match with the consensus Consensus sequences

10. In Addition to Core Promoter Elements UP (upstream promoter) elements UP (upstream promoter) elements Ex. E. coli rRNA genes Ex. E. coli rRNA genes Gene activator proteins Gene activator proteins Facilitate recognition of weak promoter Facilitate recognition of weak promoter  E. coli can regulate gene expression in many ways  E. coli can regulate gene expression in many ways

11. Stages of Transcription Template recognition Template recognition RNA pol binds to DNA RNA pol binds to DNA DNA unwound DNA unwound Initiation Initiation Elongation Elongation RNA pol moves and synthesizes RNA RNA pol moves and synthesizes RNA Unwound region moves Unwound region moves Termination Termination RNA pol reaches end RNA pol reaches end RNA pol and RNA released RNA pol and RNA released DNA duplex reforms DNA duplex reforms

12. Transcription Initiation Steps Steps Steps Formation of closed promoter (binary) complex Formation of closed promoter (binary) complex Formation of open promoter complex Formation of open promoter complex Ternary complex (RNA, DNA, and enzyme), abortive initiation Ternary complex (RNA, DNA, and enzyme), abortive initiation Promoter clearance (elongation ternary complex) Promoter clearance (elongation ternary complex) First rnt becomes unpaired First rnt becomes unpaired Polymerase loses sigma Polymerase loses sigma NusA binds NusA binds Ribonucleotides added to 3’ end Ribonucleotides added to 3’ end

13. Holoenzyme Holoenzyme Core +  Core +  Closed (Promoter) Binary Complex Closed (Promoter) Binary Complex Open binary complex Open binary complex Ternary complex Ternary complex Promoter clearance Promoter clearance Back

14. Sigma (  ) Factor Essential for recognition of promoter Essential for recognition of promoter Stimulates transcription Stimulates transcription Combines with holoenzyme Combines with holoenzyme “open hand” conformation “open hand” conformation Positions enzyme over promoter Positions enzyme over promoter Does NOT stimulate elongation Does NOT stimulate elongation Falls off after 4-9 nt incorporated Falls off after 4-9 nt incorporated “Hand” closes “Hand” closes

15. Variation in Sigma Variation in promoter sequence affects strength of promoter Variation in promoter sequence affects strength of promoter Sigmas also show variability Sigmas also show variability Much less conserved than other RNA pol subunits Much less conserved than other RNA pol subunits Several variants within a single cell. EX: Several variants within a single cell. EX: E. coli has 7 sigmas E. coli has 7 sigmas B. subtilis has 10 sigmas B. subtilis has 10 sigmas Different  respond to different promoters Different  respond to different promoters

16. Sigma Variability in E. coli Sigma70 (-35)TTGACA (-10)TATAAT Primary sigma factor, or housekeeping sigma factor. Sigma54 (-35)CTGGCAC(-10)TTGCA alternative sigma factor involved in transcribing nitrogen- regulated genes (among others). Sigma32 heat shock factor involved in activation of genes after heat shock. SigmaS (sigma38) stationary phase sigma factor. Activates genes involved in long term survival, eg. peroxidase.

17. Sigma and Phage SP01 Early promoter—recognized by bacterial sigma factor. Transcription includes product,  gp28. Early promoter—recognized by bacterial sigma factor. Transcription includes product,  gp28.  gp28 recognizes a phage promoter for expression of mid-stage genes, including  gp28 recognizes a phage promoter for expression of mid-stage genes, including  gp33/34, which recognizes promoters for late gene expression.  gp33/34, which recognizes promoters for late gene expression.

18. Promoter Clearance and Elongation Occurs after 4- 10 nt are added Occurs after 4- 10 nt are added First rnt becomes unpaired from antisense (template) strand.  DNA strands re-anneal First rnt becomes unpaired from antisense (template) strand.  DNA strands re-anneal Polymerase loses sigma, sigma recycled Polymerase loses sigma, sigma recycled Result “Closed hand” surrounds DNA Result “Closed hand” surrounds DNA NusA binds to core polymerase NusA binds to core polymerase As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. RNA pol/NusA complex stays on until termination. Rate=20-50nt/second. RNA pol/NusA complex stays on until termination. Rate=20-50nt/second.

19. Termination Occurs at specific sites on template strand called Terminators Occurs at specific sites on template strand called Terminators Two types of termination Two types of termination Intrinsic terminators Intrinsic terminators Rho (  ) dependent treminators Rho (  ) dependent treminators Sequences required for termination are in transcribed region Sequences required for termination are in transcribed region Variation in efficiencies. Variation in efficiencies.

20. Intrinsic Terminators DNA template contains inverted repeats (G-C rich) DNA template contains inverted repeats (G-C rich)  Can form hairpins  Can form hairpins 6 to 8 A sequence on the DNA template that codes for U 6 to 8 A sequence on the DNA template that codes for U Consequences of poly-U:poly-A stretch? Consequences of poly-U:poly-A stretch?

21. UUUUU Intrinsic Termination RNA pol passes over inverted repeats RNA pol passes over inverted repeats Hairpins begin to form in the transcript Hairpins begin to form in the transcript Poly-U:poly-A stretch melts Poly-U:poly-A stretch melts RNA pol and transcript fall off RNA pol and transcript fall off

22. Rho (  ) Dependent Terminators rho factor is ATP dependent helicase rho factor is ATP dependent helicase catalyses unwinding of RNA: DNA hybrid catalyses unwinding of RNA: DNA hybrid

23. (17 bp) Rho Dependent Termination rho factor is ATP dependent helicase rho factor is ATP dependent helicase catalyzes unwinding of RNA: DNA hybrid catalyzes unwinding of RNA: DNA hybrid 50~90 nucleotides/ sec 50~90 nucleotides/ sec

24. hexamer Rho: Mechanism Rho binds to transcript at  loading site (up stream of terminator) Hairpin forms, pol stalls Rho helicase releases transcript and causes termination

25. Abortive initiation, elongation

26. mRNA Function—Transcribe message from DNA to protein synthesis machinery Function—Transcribe message from DNA to protein synthesis machinery Codons Codons Bacterial—polycistronic Bacterial—polycistronic Eukaryotic– monocistronic Eukaryotic– monocistronic Leader sequence—non-translated at 5’ end Leader sequence—non-translated at 5’ end May contain a regulatory region (attenuator) May contain a regulatory region (attenuator) Also untranslated regions at 3’ end. Also untranslated regions at 3’ end. Spacers (untranslated intercistronic sequences) Spacers (untranslated intercistronic sequences) Prokaryotic mRNA—short lived Prokaryotic mRNA—short lived Eukaryotic mRNA-can be long lived Eukaryotic mRNA-can be long lived

27. Stable RNA rRNA -Structural component of ribosomes rRNA -Structural component of ribosomes tRNA-Adaptors, carry aa to ribosome tRNA-Adaptors, carry aa to ribosome Synthesis Synthesis Promoter and terminator Promoter and terminator Post-transcriptional modification (RNA processing) Post-transcriptional modification (RNA processing) Evidence Evidence Both have 5’ monophospates Both have 5’ monophospates Both much smaller than primary transcript Both much smaller than primary transcript tRNA has unusual bases. EX pseudouridine tRNA has unusual bases. EX pseudouridine

28. Eukaryotic Transcription 3 classes RNA pol (I-III) 3 classes RNA pol (I-III) Many mRNA long lived Many mRNA long lived 5’ and 3’ ends of mRNA modified. EX. 5’ and 3’ ends of mRNA modified. EX. 5’ cap 5’ cap Poly-A tail Poly-A tail Primary mRNA transcript large, introns removed Primary mRNA transcript large, introns removed Monocistronic Monocistronic

29. Eukaryotic Transcription Regulation very complex Regulation very complex Three different pols distinguished by  - amanitin sensitivity Three different pols distinguished by  - amanitin sensitivity Pol I—rRNA, least sensitive Pol I—rRNA, least sensitive Pol II– mRNA, most sensitive Pol II– mRNA, most sensitive Pol III– tRNA and 5R RNA moderately sensitive Pol III– tRNA and 5R RNA moderately sensitive Each polymerase recognizes a distinct promoter Each polymerase recognizes a distinct promoter

30. Eukaryotic RNA Polymerases RNA Pol.LocationProducts  -Amanitin Sensitivity Promoter INucleolus Large rRNAs (28S, 18S, 5.8S) Insensitive bipartite promoter IINucleus Pre-mRNA, some snRNAs Highly sensitive Upstream IIINucleus tRNA, small rRNA (5S), snRNA Intermediate sensitivity Internal promoter and terminator

31. RNA Pol. LocationProducts  - Amanitin sensitivity INucleolus Large rRNAs (28S, 18S, 5.8S) Insensitive IINucleus Pre-mRNA, some snRNAs, snoRNAs Highly sensitive IIINucleus tRNA, small rRNA (5S), snRNA Intermediate sensitivity Eukaryotic RNA Polymerases