1. Today… Genome 351, 12 April 2013, Lecture 4 mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division Please be sure to turn in your first problem set assignment today, and also pick up the second problem set http://courses.washington.edu/gen351/

2. In bacteria (most) mRNAs are co-linear with their corresponding genes +1 Promoter terminator bacteria: (pre-mRNA) (processed mRNA) eukaryotes: introns exons AACUGACGA AACTGACGA mRNA AACGA gene Transcription Translation introns are removed during transcription in the nucleus

3. Events involved in RNA processing Non- coding Coding sequence Noncoding Exon1Exon2 Intron Non- coding Continuous stretch of coding sequence AAAAA Add a string of A’s to the end Non- coding Continuous stretch of coding sequence Intron removed Splice out the intron Transport to the cytoplasm Pre-mRNA Processed-mRNA

4. Proteins can be modular -Different regions can have distinct functions and the modules can correspond to exons Why does transcript splicing occur?

5. Interrupted structure allows genes to be modular secretion cell anchor enzyme binding module introns exons introns can also lie in untranslated sequences untranslated sequences

6. Interrupted structure allows genes to be modular secretion cell anchor enzyme binding module introns exons introns can also lie in untranslated sequences untranslated sequences Pre-mRNA:

7. secretion cell anchor enzyme binding module secretion cell anchor enzyme binding module Pre-mRNA: Processed-mRNA Interrupted structure allows genes to be modular secretion cell anchor enzyme binding module AAAA This form stays anchored to the plasma membrane Three introns removed polyA tail added

8. secretion cell anchor enzyme binding module secretionenzyme Pre-mRNA: Processed-mRNA Alternative splicing or: One mRNAs exon is another one’s intron! AAAAsecretionenzyme binding module This form is secreted Three introns & an exon removed one alternative form

9. secretion cell anchor enzyme binding module enzyme Pre-mRNA: Processed-mRNA Alternative splicing or: One mRNAs exon is another one’s intron! AAAA enzyme binding module This form is retained in the cytoplasm Three introns & two exons removed another alternative form Many additional possibilities with alternative splicing

10. New York Times

11. ApoE gene Promoter exons cys 112158 cysarg ApoE2 ApoE3 ApoE4 112158Allele 10-30-fold increased risk of AD 8% 78% 14% worldwide frequency

12. How do RNA polymerases know where to begin transcription and which way to go? promoter mRNA promoter gene mRNA promoter First worked out in bacteria by: -comparing sequences near the start sites of transcription of many genes -by studying where RNA polymerase likes to bind to DNA

13. Comparing sequences at the promoter region of many bacterial genes provides clues: How do RNA polymerases know where to begin transcription and which way to go? consensus sequence: TTGACAT…15-17bp…TATAAT transcription start site direction of transcription +1-10 region-35 region are these important? only coding (sense) strand is shown; all sequences 5’-3’ Promoter Strength (# of mRNAs made/time) Relatedness of promoter to consensus TTGACAT…15-17bp…TATAAT -35 -10 ACAGTGA…15-17bp…CTGTCA -35 -10

14. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: +1-10 region-35 region T A T AA T direction of transcription Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction? TT GACA T RNA polymerase -35 binding part of RNA polymerase -10 binding part of RNA polymerase

15. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: +1-10 region-35 region T A T AA T direction of transcription Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction? TT GACA T RNA polymerase -10 binding part of RNA polymerase -35 binding part of RNA polymerase

16. RNA polymerase binds to the consensus sequences in bacterial promoters +1-10 region-35 region T A T AA T TT GACA T RNA polymerase direction of transcription RNA polymerase T AA T A T T ACAG TT direction of transcription Would you expect RNA polymerase to bind this sequence and initiate transcription? 5’3’ 5’ 3’ 5’ TTGACAT 3’3’ TTGACAT 5’ = These are chemically distinct molecules with different 3-D shapes!!

17. mRNA gene mRNA How do RNA polymerases know where to begin transcription and which way to go? In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase: -10 region-35 region TTGACATTATAAT -35 region -10 region TACAGTT TAATAT similar principles- but a different mechanism-orients RNA polymerase in eukaryotes

18. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase: +1 RNA polymerase does not efficiently bind to DNA and activate transcription on its own

19. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase:transcription factors (TF’s): +1 RNA polymerase does not efficiently bind to DNA and activate transcription on its own +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription

20. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase: Some TF’s can also inhibit transcription transcription factors (TF’s): +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription RNA polymerase does not efficiently bind to DNA and activate transcription on its own

21. Switches and Regulators - A Metaphor Switches control transcription (which take the form of DNA sequence) - Called regulatory elements (RE’s) or enhancers - Adjoin the promoter region, but can be quite distant Regulators, which take the form of proteins that bind the DNA, operate the switches - Called transcription factors (TF’s) When and how much RNA is made often is the product of multiple elements and regulators

22. Control of gene expression Each cell contains the same genetic blueprint Cell types differ in their protein content Some genes are used in almost all cells (housekeeping genes) Other genes are used selectively in different cell types or in response to different conditions.

23. An imaginary regulatory region Promoter RE1 RE2 RE3 RE4 RE5 RE6 Controls timing of transcription Inhibits transcription Increases transcription Turns on in brain

24. Antennapedia gene is normally only transcribed in the thorax; legs are made. A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae! Example: Antennapedia gene in fruit flies Expressing a regulatory gene in the wrong place can have disastrous consequences!!!

25. Lactose tolerance: A human example of a promoter mutation

26. Lactase levels in humans Lactase levels Age in years 2 10 lactose intolerant lactose tolerant

27. World wide distribution of lactose intolerance Convergent evolution: independent acquisition of the same biological trait in distinct populations

28. The cellular life cycle fertilized egg; a single cell! How is the genetic material equally divided during mitosis? The formation of sperm and eggs-more later on this subject Mitosis: dividing the content of a cell

29. Chromosomes - a reminder How many do humans have? Photo: David McDonald, Laboratory of Pathology of Seattle 22 pairs of autosomes 2 sex chromosomes Each parent contributes one chromosome to each pair Chromosomes of the same pair are called homologs Others are called non- homologous

30. Homologous and non-homologous chromosomes 1p1p 1m1m 2p2p 2m2m 3p3p 3m3m 21 p 22 m 22 p 21 m X p or Y XmXm homologous non-homologous The zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome homologous

31. The DNA of human chromosomes # genes# base pairs# genes# base pairs

32. The cellular life cycle cell growth; chromosome duplication chromosomes decondensed cell growth; chromosome duplication Elements of mitosis: What are decondensed chromosomes? How are chromosomes duplicated?

33. Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) a condensed chromosome

34. Chromosome replication – a reminder Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once. The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)

35. The cellular life cycle cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat Elements of mitosis: only showing a single duplicated homolog – 45 others not shown

36. Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) a condensed chromosome sister chromatids; double- stranded DNA copies of the SAME homolog held together at the centromere

37. The cellular life cycle cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat Elements of mitosis: only showing a single duplicated homolog – 45 others not shown

38. The cellular life cycle cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat Elements of mitosis:

39. Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes Understand what’s happening to the chromosomes! Copied chromosomes (sister chromatids) stay joined together at the centromere. Proteins pull the two sister chromatids to opposite poles Each daughter cell gets one copy of each homolog.

40. Mitosis -- homologous chromosomes 1m1m 1p1p 2 copies 1 m 2 copies 1 p 1m1m 1p1p 1m1m 1p1p joined at centromer e 2 copies 1 m 1m1m 1p1p 1m1m 1p1p 2 copies 1 p exact copies

41. Mitosis – following the fate of CFTR 1m1m 1p1p 2 copies 1 m 2 copies 1 p 1m1m 1p1p 1m1m 1p1p joined at centromer e 2 copies 1 m 1m1m 1p1p 1m1m 1p1p 2 copies 1 p exact copies

42. Mitosis – following the fate of CFTR CFTR + CFTR - CFTR + CFTR - 2 copies CFTR + 2 copies CFTR - 2 copies CFTR + 2 copies CFTR - CFTR + CFTR - CFTR + CFTR - exact copies CFTR + CFTR - A CFTR heterozygote (CFTR + /CFTR - )

43. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Mitosis -- 2 copies of each chromosome at the start Paternal chromosome Maternal chromosome A closer look at the chromosomes

44. GTGCACCTGACTCCTGAGGAG CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG DNA strands separate followed by new strand synthesis A closer look at the chromosomes

45. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Mitosis -- after replication 4 copies Homologs unpaired; sister chromatids joined by centromere GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC A closer look at the chromosomes

46. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Each daughter has a copy of each homolog GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC A closer look at the chromosomes

47. Mitosis and the cell cycle DNA synthesis Chromosome condensation Chromosome alignment One copy of each chromosome to each daughter Nuclear membrane breakdown

48. Mitosis vs. Meiosis Meiosis: the formation of gametes Mitosis: dividing somatic cells - The goal of mitosis is to make more “somatic” cells: each daughter cell should have the same chromosome set as the parental cell - The goal of meiosis is to make sperm and eggs: each daughter cell should have half the number of chromosome sets as the parental cell number of copies of any given chromosome/cell (n): number of copies of any given chromosome/sperm or egg: 2 1 1n 2n

49. 4n!! 2n 1n 2n zygote: Why reduce the number of chromosome sets during meiosis? 2n = diploid 1n = haploid

50. Meiosis: the formation of gametes The challenge: ensuring that homologues are partitioned to separate gametes The solution: Hold homologous chromosomes together by crossing over target homologues to opposite poles of the cell… then separate the homologues 3 other combinations possible! 1n 2n