1. Bioengineering
Biology
Ch.13
Ms. Haut

2. Copyright Pearson Prentice Hall
13-2 Manipulating DNA
Copyright Pearson Prentice Hall

3. The Tools of Molecular Biology
Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules.
Copyright Pearson Prentice Hall

4. The Tools of Molecular Biology
Scientists use different techniques to:
extract DNA from cells
cut DNA into smaller pieces
identify the sequence of bases in a DNA molecule
make unlimited copies of DNA
Copyright Pearson Prentice Hall

5. The Tools of Molecular Biology
In genetic engineering, biologists make changes in the DNA code of a living organism.
Copyright Pearson Prentice Hall

6. The Tools of Molecular Biology
DNA Extraction
DNA can be extracted from most cells by a simple chemical procedure.
The cells are opened and the DNA is separated from the other cell parts.
Copyright Pearson Prentice Hall

7. The Tools of Molecular Biology
Cutting DNA 
Most DNA molecules are too large to be analyzed, so biologists cut them into smaller fragments using restriction enzymes.
Enzymes found in bacteria used to destroy phage DNA
Copyright Pearson Prentice Hall

8. The Tools of Molecular Biology
Each restriction enzyme cuts DNA at a specific sequence of nucleotides.
Molecular biologists have developed different techniques that allow them to study and change DNA molecules. Restriction enzymes cut DNA at specific sequences. This drawing shows how restriction enzymes are used to edit DNA. The restriction enzyme EcoR I, for example, finds the sequence CTTAAG on DNA. Then, the enzyme cuts the molecule at each occurrence of CTTAAG. The cut ends are called sticky ends because they may “stick” to complementary base sequences by means of hydrogen bonds.

9. The Tools of Molecular Biology
A restriction enzyme will cut a DNA sequence only if it matches the sequence precisely.

10. The Tools of Molecular Biology
Separating DNA  
In gel electrophoresis, DNA fragments are placed at one end of a porous gel, and an electric voltage is applied to the gel.
When the power is turned on, the negatively-charged DNA molecules move toward the positive end of the gel.
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

11. The Tools of Molecular Biology
Gel electrophoresis can be used to compare the genomes of different organisms or different individuals.
It can also be used to locate and identify one particular gene in an individual's genome.
Copyright Pearson Prentice Hall

12. The Tools of Molecular Biology
DNA Fingerprinting
A method of developing a person’s DNA “profile,” similar to a fingerprint.
Pioneered in England in 1984 by Dr. Alec Jeffreys
Dr. Alec Jeffreys

13. First Forensic Use
First used by law enforcement in England in the mid-1980’s.
DNA evidence exonerated one man, and convicted another.
Described in The Blooding, by Joseph Wambaugh

14. How does it work? 99.9% of your DNA is the same as everyone else’s.
The 0.1% that differs are a combination of:
Gene differences (Differences in the genes themselves)
Differences in “polymorphic regions” between the genes on the DNA.

15. How does it work?
Certain points between the genes on the DNA have repeating base sequences.
For example: ATTACGCGCGCGCGCGCGCTAGC
These are called variable number tandem repeats (VNTRs for short)

16. How does it work?
Everyone has VNTRs at the same place in their DNA, but they are different lengths for different people.
For example: Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats) Person 2: ATTACGCGCGCGCGTAGC (5 repeats)

17. To Make a DNA Fingerprint…
First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths.
Some of the fragments contain STRs; some do not. The ones that do are different lengths for different people.

18. To Make a DNA Fingerprint…
There are slight differences in DNA sequences as seen in individuals of the same species
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

19. To Make a DNA Fingerprint…
Next, we use gel electrophoresis to sort the DNA fragments by size.

20. Gel Electrophoresis
Method for sorting proteins or nucleic acids on the basis of their electric charge and size

21. Gel Electrophoresis
Electrical current carries negatively-charged DNA through gel towards positive electrode
Agarose gel sieves DNA fragments according to size
Small fragments move farther than large fragments
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

22. Gel Electrophoresis
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

23. To Make a DNA Fingerprint…
Figure 12.11C
Restriction fragment preparation 1
Restriction fragments
Gel electrophoresis 2
Blotting 3
Filter paper
Probe
Radioactive probe 4
Detection of radioactivity (autoradiography) 5
Film
To Make a DNA Fingerprint…
Finally, a radioactive probe attaches to our VNTRs. Only the fragments with our VNTRs will show up on the gel.
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

25. To Make a DNA Fingerprint…
Since VNTRS are different lengths in different people, this creates a DNA Fingerprint.

26. Two uses for DNA Fingerprints...
Forensics DNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects. Real-life CSI!

27. Two uses for DNA Fingerprints...
Forensics This is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?

28. Two uses for DNA Fingerprints...
Paternity Testing Since all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!

29. Two uses for DNA Fingerprints...
Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?”
Yes. This is a “positive” test for paternity.

30. Two uses for DNA Fingerprints...
How about this gel? Do both of the child’s markers match either the mother or the “alleged father.”
No! The “alleged father” is not this child’s biological parent.

31. Interpreting DNA Fingerprints
Which child is not related to the mother?
Son 2
Which children are not related to the father?
Daughter 2 and Son 2

32. Interpreting DNA Fingerprints
A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects?
Suspect 3

33. Interpreting DNA Fingerprints
Who committed this sexual assault?
Suspect 1

34. Interpreting DNA Fingerprints
These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy?
2nd alleged father

35. Interpreting DNA Fingerprints
Mother, father, and four children. Which child is from a different father?
Child 2

36. Interpreting DNA Fingerprints
These DNA fingerprints are from a rape case. Did the defendant commit this crime?

37. Interpreting DNA Fingerprints
Four different sets of twins. Which sets are identical twins (identical twins have identical DNA)

38. Copyright Pearson Prentice Hall
Using the DNA Sequence
Cutting and Pasting 
Short sequences of DNA can be assembled using DNA synthesizers.
“Synthetic” sequences can be joined to “natural” sequences using enzymes that splice DNA together.
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.
Copyright Pearson Prentice Hall

39. Copyright Pearson Prentice Hall
Using the DNA Sequence
These enzymes also make it possible to take a gene from one organism and attach it to the DNA of another organism.
Such DNA molecules are sometimes called recombinant DNA.
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.
Copyright Pearson Prentice Hall

40. Copyright Pearson Prentice Hall
Using the DNA Sequence
Making Copies 
Polymerase chain reaction (PCR) is a technique that allows biologists to make copies of genes.
A biologist adds short pieces of DNA that are complementary to portions of the sequence.
Copyright Pearson Prentice Hall

41. Copyright Pearson Prentice Hall
Using the DNA Sequence
DNA is heated to separate its two strands, then cooled to allow the primers to bind to single-stranded DNA.
DNA polymerase starts making copies of the region between the primers.
Copyright Pearson Prentice Hall

42. Copyright Pearson Prentice Hall
Restriction enzymes are used to
extract DNA.
cut DNA.
separate DNA.
replicate DNA.
Copyright Pearson Prentice Hall

43. Copyright Pearson Prentice Hall
During gel electrophoresis, the smaller the DNA fragment is, the
more slowly it moves.
heavier it is.
more quickly it moves.
darker it stains.
Copyright Pearson Prentice Hall

44. Copyright Pearson Prentice Hall
The DNA polymerase enzyme Kary Mullis found in bacteria living in the hot springs of Yellowstone National Park illustrates
genetic engineering.
the importance of biodiversity to biotechnology.
the polymerase chain reaction.
selective breeding.
Copyright Pearson Prentice Hall

45. Copyright Pearson Prentice Hall
A particular restriction enzyme is used to
cut up DNA in random locations.
cut DNA at a specific nucleotide sequence.
extract DNA from cells.
separate negatively charged DNA molecules.
Copyright Pearson Prentice Hall

46. Copyright Pearson Prentice Hall
During gel electrophoresis, DNA fragments become separated because
multiple copies of DNA are made.
recombinant DNA is formed.
DNA molecules are negatively charged.
smaller DNA molecules move faster than larger fragments.
Copyright Pearson Prentice Hall

47. Copyright Pearson Prentice Hall6
Why would someone use PCR?
To cut the DNA into fragments
To create recombinant
To make lots of copies of a DNA fragment
To make a transgenic organism
Copyright Pearson Prentice Hall