2. Control of Prokaryotic (Bacterial) Genes

3. Gene Control  Many biotech techniques make use of existing mechanisms for controlling gene expression  Gene expression = “gene activity,” the process by which information from a gene is used to synthesize a protein  All genes are not being expressed at all times

4. Discussion  Consider bacterial genes for metabolic enzymes…  Under what circumstances would the prokaryote want those genes turned OFF? Why?  Under what circumstances would the prokaryote want those genes turned ON? Why?

5. Remember Regulating Metabolism?  Feedback inhibition  product acts as an allosteric inhibitor of 1 st enzyme in tryptophan pathway  but this is wasteful production of enzymes = inhibition - - Oh, I remember this from our Metabolism Unit!

6. Different way to Regulate Metabolism  Gene regulation  instead of blocking enzyme function, block transcription of genes for all enzymes in tryptophan pathway  saves energy by not wasting it on unnecessary protein synthesis = inhibition - - -

7. Gene regulation in bacteria  Cells vary amount of specific enzymes by regulating gene transcription  turn genes on or turn genes off  turn genes OFF example if bacterium has enough tryptophan then it doesn’t need to make enzymes used to build tryptophan  turn genes ON example if bacterium encounters new sugar (energy source), like lactose, then it needs to start making enzymes used to digest lactose STOP GO

8. Gene Regulation  Regulatory sequence: a sequence of DNA that interacts with regulatory proteins to control transcription of other genes  Regulatory gene: DNA encoding a regulatory protein or RNA

9. Bacteria group genes together  Operon  genes grouped together with related functions, controlled by a single regulatory sequence  example: all enzymes in a metabolic pathway  promoter = RNA polymerase binding site  single promoter controls transcription of all genes in operon  transcribed as one unit & a single mRNA is made  operator = DNA binding site of repressor protein  structural genes = genes to be expressed

10. So how can these genes be turned off?  Repressor protein  binds to DNA at operator site  blocking RNA polymerase  blocks transcription  Effector molecule  Binds to repressor, changes its affinity for DNA binding site

11. operatorpromoter Operon model DNATATA RNA polymerase repressor = repressor protein Operon: operator, promoter & genes they control serve as a model for gene regulation gene1gene2gene3gene4 RNA polymerase Repressor protein turns off gene by blocking RNA polymerase binding site. 1234 mRNA enzyme1enzyme2enzyme3enzyme4

12. mRNA enzyme1enzyme2enzyme3enzyme4 operatorpromoter Trp operon DNATATA RNA polymerase tryptophan repressor repressor protein repressor tryptophan – repressor protein complex Synthesis pathway model When excess tryptophan is present, it binds to trp repressor protein & triggers repressor to bind to DNA  repressor without trp effector, inactive. With trp, active.  blocks (represses) transcription gene1gene2gene3gene4 conformational change in repressor protein! 1234 repressor trp RNA polymerase trp

13. Tryptophan operon What happens when tryptophan is present? Don’t need to make tryptophan-building enzymes Tryptophan is allosteric regulator of repressor protein http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio26.swf::The%20Tryptophan%20Repressor

14. mRNA enzyme1enzyme2enzyme3enzyme4 operatorpromoter Lac operon DNATATA RNA polymerase repressor repressor protein repressor lactose – repressor protein complex lactose lac repressor gene1gene2gene3gene4 Digestive pathway model When lactose is present, binds to lac repressor protein & triggers repressor to release DNA  repressor without lac effector, active. With lac, inactive.  induces transcription RNA polymerase 1234 lac conformational change in repressor protein! lac http://highered.mcgraw-hill.com/sites/dl/free/0072835125/126997/animation27.html

15. Lactose operon (notice, the lacI gene for the repressor protein precedes the promoter, handy!) But wait! What if there’s lactose AND glucose present? Glucose is a much better energy source… do we still want to bother breaking down lactose?

16. Lactose operon Lac promoter has TWO binding sites One for RNA polymerase Lac repressor protein can bind to operator and inhibit that One for CAP, catabolite activating protein, before the promoter. RNA polymerase doesn’t bind well to this gene without CAP there.

17. Lactose operon  As glucose concentration increases in a cell, the concentration of cAMP, or cyclic AMP, decreases (+glucose=-cAMP)  When cAMP binds to CAP, it has the correct conformation to bind to DNA  So, when glucose is low, the cAMP-CAP complex is bound to DNA, and RNA polymerase can attach  When glucose is high, cAMP doesn’t bind to CAP, CAP doesn’t bind to DNA, and neither does RNA polymerase

18. Lactose operon In order for the structural genes to be transcribed, the cAMP-CAP complex must be bound to the CAP binding site, AND the repressor protein must not be bound to the operator http://www.youtube.com/watch?v=2sMFswbOgKk

19. Operon Regulation  Operons can be regulated by positive or negative means…  Positive control: Regulatory proteins bind to DNA and stimulate expression.  Negative control: Regulatory proteins bind to DNA to inhibit expression.  …and can be inducible or repressible.  Inducible: “Off by default.” The effector (inducer) interacts with regulatory proteins or DNA and turns expression on.  Repressible: “On by default.” The effector (repressor) interacts with regulatory proteins or DNA turns expression off.

20. Discussion  The lac operon is termed negative inducible. Why?  The trp operon is termed negative repressible. Why?

21. Discussion  Example: In a positive repressible operon, activator proteins are normally bound to the DNA and actually provide a binding site for RNA Polymerase. It’s therefore positive: the controlling protein stimulates expression.  An inhibitor can bind to the activator protein, change its conformation, and prevent it from binding to RNA polymerase. It’s therefore repressible: it’s normally on, and the molecule turned gene expression off.  That’s positive repressible. How might a positive inducible operon work?

22. Operon function  Repressible operon  usually functions in anabolic pathways  synthesizing end products  when end product is present in excess, cell allocates resources to other uses  Inducible operon  usually functions in catabolic pathways,  digesting nutrients to simpler molecules  produce enzymes only when nutrient is available  cell avoids making proteins that have nothing to do, cell allocates resources to other uses  And some genes are continuously expressed (always turned on).  e.g. the genes that code for ribosomal complexes

23. Discussion  Before we leave operons behind (for the moment), look at their big picture. Knowing what attaches where is not the most important part, it’s only a prerequisite to this:  WHY does the trp operon function as it does? How is it advantageous? What is its adaptive significance?  WHY does the lac operon function as it does? How is it advantageous? What is its adaptive significance?

24. Control of Eukaryotic Genes

25. Eukaryotic Control  The control of gene expression in eukaryotes is complex!  Involves regulatory genes, regulatory proteins, transcription factors, and more!  Can occur at any step in the pathway from gene to functional protein: 1.packing/unpacking DNA 2.transcription 3.mRNA processing 4.mRNA transport 5.translation 6.protein processing 7.protein degradation

26. How do you fit all that DNA into nucleus?  DNA coiling & folding  double helix  nucleosomes  chromatin fiber  looped domains  chromosome from DNA double helix to condensed chromosome 1. DNA packing

27. Nucleosomes  “Beads on a string”  1 st level of DNA packing  histone proteins  8 protein molecules  positively charged amino acids  bind tightly to negatively charged DNA DNA packing movie 8 histone molecules

28. DNA packing as gene control  Degree of packing of DNA regulates transcription  tightly wrapped around histones  no transcription  genes turned off  heterochromatin darker DNA (H) = tightly packed  euchromatin lighter DNA (E) = loosely packed H E

29. DNA methylation  Methylation of DNA blocks transcription factors  no transcription  genes turned off  attachment of methyl groups (–CH 3 ) to cytosine  C = cytosine  nearly permanent inactivation of genes  ex. inactivated mammalian X chromosome = Barr body

30. Histone acetylation  Acetylation of histones unwinds DNA  loosely wrapped around histones  enables transcription  genes turned on  attachment of acetyl groups (–COCH 3 ) to histones  conformational change in histone proteins  transcription factors have easier access to genes

31. 2. Transcription initiation  transcription factors = proteins that bind to DNA to regulate transcription  Some are activators, increase expression  Others are repressors, decrease expression  Actual rate of expression  Depends on combination of transcription factors

32. 2. Transcription initiation  Example control regions on DNA  Promoter sequence  nearby control sequence on DNA  binding of RNA polymerase & transcription factors  “base” rate of transcription  Enhancer sequence  distant control sequences on DNA  binding of activator proteins  “enhanced” rate (high level) of transcription

33. Transcription complex Enhancer Activator Coactivator RNA polymerase II A B F E H TFIID Core promoter and initiation complex Activator Proteins regulatory proteins bind to DNA at distant enhancer sites increase the rate of transcription Coding region T A Enhancer Sites regulatory sites on DNA distant from gene Initiation Complex at Promoter Site binding site of RNA polymerase

34. Discussion  That’s how an activator binds to a promoter or enhancer to increase expression…  How could it work that I could attach a repressor or “silencer” protein to those same sequences to decrease expression? http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio28.swf::Transcription%20Complex%20and%20Enhancers

35. 3. Post-transcriptional control  Alternative RNA splicing  variable processing of exons creates a family of proteins

36. RNA interference  Small interfering RNAs (siRNA)  short segments of RNA (21-28 bases)  bind to mRNA  create sections of double-stranded mRNA  “death” tag for mRNA  triggers degradation of mRNA  cause gene “silencing”  post-transcriptional control  turns off gene = no protein produced NEW! siRNA

37. Action of siRNA siRNA double-stranded miRNA + siRNA mRNA degraded functionally turns gene off Hot…Hot new topic in biology mRNA for translation breakdown enzyme (RISC) dicer enzyme

38. 5. Control of translation  Block initiation of translation stage  regulatory proteins attach to 5' end of mRNA  prevent attachment of ribosomal subunits & initiator tRNA  block translation of mRNA to protein

39. 6-7. Protein processing & degradation  Protein processing  folding, cleaving, adding sugar groups, targeting for transport  Protein degradation

40. initiation of transcription 1 mRNA splicing 2 mRNA protection 3 initiation of translation 6 mRNA processing 5 Of turning genotypic diversity into even greater phenotypic diversity! 7 protein processing & degradation 4 4 Many methods

41. Discussion  Work together with someone else, get a blank piece of paper, and:  Summarize the most important take- home message or messages about control of gene expression... using only pictures and no text. (They don’t have to be pictures of DNA/RNA/etc itself!)

42. AP Biology 2007-2008 Biotechnology

43. AP Biology A Brave New World

44. AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

45. AP Biology Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with  this unit is a survey of those tools… Our tool kit…

46. AP Biology Bacteria  Bacteria review  one-celled prokaryotes  reproduce by mitosis  binary fission  rapid growth  generation every ~20 minutes  10 8 (100 million) colony overnight!  dominant form of life on Earth  incredibly diverse

47. AP Biology Bacterial genome  Single circular chromosome  haploid  naked DNA  no histone proteins  ~4 million base pairs  ~4300 genes  1/1000 DNA in eukaryote How have these little guys gotten to be so diverse??

48. AP Biology Genetic Diversity  Living things, eukaryotes and prokaryotes, have a variety of ways of mixing up genetic information “horizontally”  Transduction: Viral transmission of genetic material  Transposition: Movement of DNA segments within and between DNA molecules  And prokaryotes have unique methods  Conjugation: Cell-to-cell transfer of genetic material  And…

49. AP Biology Transformation  Bacteria are opportunists  pick up naked foreign DNA wherever it may be hanging out  have surface transport proteins that are specialized for the uptake of naked DNA  import bits of chromosomes from other bacteria  incorporate the DNA bits into their own chromosome  express new genes  transformation  form of recombination mix heat-killed pathogenic & non-pathogenic bacteria mice die

50. AP Biology Plasmids  Small supplemental circles of DNA  5000 - 20,000 base pairs  self-replicating  carry extra genes  2-30 genes  genes for antibiotic resistance  can be exchanged between bacteria  Conjugation: “bacterial sex”  rapid evolution  can be imported from environment  transformation

51. AP Biology How can plasmids help us?  A way to get genes into bacteria easily  insert new gene into plasmid = vector  insert plasmid into bacteria  bacteria now expresses new gene  bacteria make new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA

52. AP Biology Biotechnology  Plasmids used to insert new genes into bacteria gene we want cut DNA cut plasmid DNA insert “gene we want” into plasmid... “glue” together ligase like what? …insulin …HGH …lactase recombinant plasmid

53. AP Biology How do we cut DNA?  Restriction enzymes  restriction endonucleases  evolved in bacteria to cut up foreign DNA  “restrict” the action of the attacking organism  protection against viruses & other bacteria  bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNA 

54. AP Biology How do restriction enzymes work?  Take a normal piece of paper.  Tear/cut it into 3 long segments (tear from top to bottom)  On each segment, write a random stream of DNA bases and their complementary base pairs.  When you’re done, help me lay them all out end to end and tape them together so we have a nice long chromosome to demonstrate this with!

55. AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog palindromes

56. AP Biology Restriction enzymes  Action of enzyme  cut DNA at specific sequences  restriction site  symmetrical “palindrome”  produces protruding ends  sticky ends  will bind to any complementary DNA  Many different enzymes  named after organism they are found in  EcoRI (GAATTC, E. coli), HindIII (AAGCTT, Hemophilus influenzae), BamHI (GGATCC, Bacillus amyloli)… Madam I’m Adam CTGAATTCCG GACTTAAGGC CTG|AATTCCG GACTTAA|GGC  

57. AP Biology Restriction enzymes  Cut DNA at specific sites  leave “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGC TT CATTGCTTAAGTGCG AA restriction enzyme cut site

58. AP Biology Sticky ends  Cut other DNA with same enzymes  leave “sticky ends” on both  can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

59. AP Biology Sticky ends help glue genes together TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCA CGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGT GCGAA gene you wantcut sites AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA chromosome want to add gene tocut sites AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene sticky ends chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC sticky ends stick together DNA ligase joins the strands Recombinant DNA molecule http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120078/bio37.swf::Restriction%20Endonucleases

60. AP Biology Demo  Suppose we add this sequence:  …o a solution containing these enzymes (whose restriction sites are):  EcoRI (5’ G|AATTC 3’)  HindIII (5’ A|AGCTT 3’)  BamHI (5’ G|GATCC 3’)  How many pieces of DNA would I have? 5’ ATCGGTTAAGCTTGGGCAACGGATCCGAGATCATCGT 3’

61. AP Biology Why mix genes together? TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC  Gene produces same protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin How can bacteria read human DNA?

62. AP Biology The code is universal  Since all living organisms…  use the same DNA  use the same code book  read their genes the same way

63. AP Biology Copy (& Read) DNA  Transformation  insert recombinant plasmid into bacteria  grow recombinant bacteria in agar cultures  bacteria make lots of copies of plasmid  “cloning” the plasmid  production of many copies of inserted gene!  production of “new” protein  transformed phenotype DNA  RNA  protein  trait

64. AP Biology Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

65. AP Biology Discussion  But suppose I want to move a gene from a bacterium into a multicellular eukaryote…  I can inject a plasmid directly, but that’s tedious and not highly effective  Think back to the last unit… how could VIRUSES be used to accomplish this purpose?

66. AP Biology Uses of genetic engineering  Genetically modified organisms (GMO)  enabling plants to produce new proteins  Protect crops from insects: BT corn  corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)  Extend growing season: fishberries  strawberries with an anti-freezing gene from flounder  Improve quality of food: golden rice  rice producing vitamin A improves nutritional value

67. AP Biology Green with envy?? Jelly fish “GFP” Transformed vertebrates

68. AP Biology Cut, Paste, Copy, Find…  Word processing metaphor…  cut  restriction enzymes  paste  ligase  copy  plasmids  bacterial transformation  is there an easier way??  find  ????