Download presentation
Presentation is loading. Please wait.
Published byMavis Allison Modified over 9 years ago
2
AP Biology 2007-2008 From Gene to Protein How Genes Work
3
AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation
4
AP Biology 2007-2008 Translation from nucleic acid language to amino acid language
5
AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 4 20 ATCG AUCG
6
AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon
7
AP Biology Cracking the code 1960 | 1968 Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT
8
AP Biology The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Start codon AUG methionine Stop codons UGA, UAA, UAG Why is the wobble good?
9
AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 53 35 35 UAC Met GCA Arg CAU Val
10
AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation
11
AP Biology Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end
12
AP Biology Loading tRNA Aminoacyl tRNA synthetase (don’t need to know name) enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O
13
AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon Structure ribosomal RNA (rRNA) & proteins 2 subunits large small EP A
14
AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site
15
AP Biology Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'
16
AP Biology Translation
17
AP Biology Can you tell the story?
18
AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.