1. 1 PROTEIN SYNTHESIS

2. DNA and Genes

3. DNA DNA contains genes, sequences of nucleotide bases These Genes code for proteins Proteins are used to build cells and do much of the work inside cells

4. 4 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist

5. 5 Polypeptides Amino acid chains are called polypeptides

6. 6 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes

7. 7 Starting with DNA DNA ‘s code must be copied and taken to the cytoplasmDNA ‘s code must be copied and taken to the cytoplasm In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins)In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESISThis process is called PROTEIN SYNTHESIS

8. RNA

9. 9 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan

10. 10 RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose

11. 11 Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-strandedRNA molecule is single-stranded DNA is double- stranded DNA

12. 12 Structure of RNA

13. 13. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

14. 14 Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T )

15. 15 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

16. 16 Ribosomal RNA (rRNA) Globular in shapeGlobular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis

17. 17 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Three codons tell the ribosome to stop translating

18. 18 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine

19. 19 Name the Amino Acids GGG? UCA? CAU? GCA? AAA?

20. 20

21. 21 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G

22. 22 Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon

23. 23 Transfer RNA amino acid attachment site UAC anticodon

24. 24 Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU

25. Transcription and Translation

26. 26 Pathway to Making a Protein (Central Dogma) DNAmRNA tRNA (ribosomes) Protein

27. 27 Protein Synthesis  Two phases: Transcription & Translation  Transcription is the process the creates mRNA, tRNA, and rRna!

28. 28 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand

29. 29 Transcription

30. 30 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

31. 31 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

32. 32 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes

33. 33 Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

34. 34 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment

35. 35 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

36. Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids

37. 37 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

38. 38 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

39. 39 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

40. 40 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

41. 41 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

42. 42 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

43. 43 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

44. 44 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

45. 45 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

46. 46 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon codon 2codon 3codon 4codon 5codon 6codon 7codon 1