1. 1 DNA  RNA  Protein DNA  mRNA  Protein Nuclear membrane Transcription Translation DNA mRNA Ribosome Protein Eukaryotic Cell

2. 2 What is the name of this pathway to making a protein? DNAmRNAProtein 1. mRNA is transcribed from DNA 2. mRNA is translated into a protein Transcription Translation

3. 3 RNA Vocabulary

4. codon Each group of three nitrogenous bases located on mRNA. 4

5. ribosomal RNA (rRNA) The two-part ribosome that reads mRNA 5

6. amino acid Create proteins when arranged in a chain. 6

7. transfer RNA (tRNA) Carries amino acids from the cytoplasm to the ribosome 7 U AC methionine

8. anticodon Each group of nitrogenous bases that complements a codon. These groups of bases are located on tRNA. 8

9. 9 Making a Protein

10. 10 Protein Synthesis  The production (creation) of proteins  Two phases: Transcription & Translation  mRNA must be made before it leaves the nucleus of eukaryotic cells

11. 11 Translation Three steps:Three steps: 1.initiation: start codon (AUG) 2.elongation: amino acids linked 3.termination: stop codon (UAG, UAA, or UGA). Let’s Make a Protein !

12. 12 mRNA Codons Join the Ribosome P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

13. 13 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

14. 14 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

15. 15 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

16. 16 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

17. 17 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

18. 18 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

19. 19 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

20. 20 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

21. 21 End Product –The Protein! The end products of protein synthesis is a primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bondsA sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

22. Kno-Gen Review 22

23. 1) Transcription 23

24. 24 2) Translation methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Example structure of a protein aa peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

25. 25 A codon chart does not need to be memorized.