Presentation is loading. Please wait.

Presentation is loading. Please wait.

AP Biology 2007-2008 From Gene to Protein How Genes Work.

Similar presentations


Presentation on theme: "AP Biology 2007-2008 From Gene to Protein How Genes Work."— Presentation transcript:

1

2 AP Biology 2007-2008 From Gene to Protein How Genes Work

3 AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

4 AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait

5 AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis

6 AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

7 AP Biology 2007-2008 Transcription from DNA language to RNA language

8 AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA RNADNA transcription

9 AP Biology Transcription Making mRNA  transcribed DNA strand = template strand  enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

10 AP Biology Initiation Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase

11 AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

12 AP Biology Termination Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)

13 AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous  exons = the real gene expressed / coding DNA  introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

14 AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing edit out introns  make mature mRNA transcript ~10,000 bases ~1,000 bases

15 AP Biology Splicing must be accurate No room for mistakes!  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

16 AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5'

17 AP Biology Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons

18 AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail  longer tail, mRNA lasts longer: produces more protein

19 AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

20 AP Biology 2007-2008 Translation from nucleic acid language to amino acid language

21 AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 4 20 ATCG AUCG

22 AP Biology mRNA codes for proteins in triplets

23 AP Biology Cracking the code 1960 | 1968 Crick  determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17)  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

24 AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG

25 AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 53 35 35 UAC Met GCA Arg CAU Val

26 AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

27 AP Biology Transfer RNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

28 AP Biology Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

29 AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small EP A

30 AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

31 AP Biology Building a polypeptide Initiation  brings together mRNA, ribosome subunits, initiator tRNA Elongation  adding amino acids based on codon sequence Termination  end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

32 AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

33 AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

34 AP Biology AAAAAAAAGTP 20-30b 3' promoter introns The Transcriptional unit (gene?) transcriptional unit (gene) DNA TATA 5' RNA polymerase pre-mRNA 5'3' mature mRNA 5'3' exons enhancer 1000 + b


Download ppt "AP Biology 2007-2008 From Gene to Protein How Genes Work."

Similar presentations


Ads by Google