1. VectorBase Vectorbase probe mapping

2. VectorBase Automatic Annotation browser Array data CHADO Manual Annotation XML vectorbase Automatic Annotation

3. VectorBase Integration aims Contigview – View alignment track Geneview – Reporters – experiments – Expression patterns? Reporter page – Positions mapped – Genes overlapped – Experiments used in

4. VectorBase Linked to location: Feature track Link to BASE Detail popup: st-end, name, %id… contigview

5. VectorBase Associated with gene: Reporter Experiments(?) geneview

6. VectorBase Slow Delayed data flow Limited scope for adaptation – a load of links… DAS Vs. e !

7. VectorBase DAS server DB request browser DAS - request:response

8. VectorBase Automatic Annotation browser Array data CHADO Manual Annotation XML DAS 1 2 3 data flow 23 4 name chr::start-end::strand

9. VectorBase Slow Delayed data flow Limited scope for adaptation – a load of links… DAS Vs. e ! Fast Data generated with new assembly Fully integrated with ensembl – Pages are extendable & adaptable

10. VectorBase cf affy_feature affy feature

11. VectorBase featureview

12. VectorBase est sequences Is feature associated with any external databases? (i.e. EMBL) Xref ContigView display track FeatureView positions in genome > 97% identity > 90% coverage DNA_Align_Feature GeneView display information with associated gene FeatureView positions in genome other features est is associated with e! features

13. VectorBase probe types MMC1 – Spotted array: cDNA clones MMC2 – Spotted array: PCR products Affy -Short oligo tiling path -Agilent -Long oligo, tiling path? Already handled by ensembl

14. VectorBase DNA_Align_Feature (ESTs) MMC1 (clones) exonerate: EST2genes Misc_Feature (REPORTER) collapse ESTs into clones ContigView display all features in ‘probes’ track FeatureView: positions in genome 1 - est2reporter

15. VectorBase 2L 3R est1 est2 len est2 len (est2)+len (est1) est1 est2 300bp 500bp 500 = 500 500 + 300 = 800 2 - est2reporter

16. VectorBase 2L 3R est1 est2 len est2 len (est2)+len (est1) est1 est2 50bp 500bp 500 = 500 500 + 50 = 550 est2 3 - est2reporter

17. VectorBase DNA_Align_Feature (ESTs) MMC1 (clones) exonerate: EST2genes Marker_Feature (PCR primers) MMC2 (primers) e-PCR assess significance? Misc_Feature (REPORTER) collapse ESTs into clones ContigView display all features in ‘probes’ track FeatureView: positions in genome pcr2reporter

18. VectorBase 2L 3R 550bp => map weight 0 100bp => map weight 1 800bp => map weight 1 idleft_primerright_primerdistancenameaccessionspecies 1.1.1GATTACAACATCCAGAAGGAGTCGTAGTACTTGAGGACAGCAAG 104 ENSANGG00000020724 A.gambiae 1.1.10GCCTTTGCCGGGCTGCTTCGGGGGTTTCGAGCAG 497 ENSANGG00000002666 A.gambiae 1.1.11GATAATTCAGCGCTACACATTACACCGTAATGCTAACATCGAA 146 ENSANGG00000002705 A.gambiae 1.1.11GATAATTCAGCGCTACACATTACACCGTAATGCTAACATCGAA 146 ENSANGG00000020019 A.gambiae 1.1.12CAGTGCTACGTGAAGAATGATCCGCTGTCGAGGGAAC 473 ENSANGG00000003095 A.gambiae 1.1.2TCGTCCAACAGTTTCTCCTACGATCGTTTGCTGCTTGCATA 449 ENSANGG00000000521 A.gambiae sts pipeline

19. VectorBase 2L ENSANG00012345: MMC2: 9713 MMC1: 4A3B-AAG-D08 1 - reporter2gene

20. VectorBase DNA_Align_Feature (ESTs) MMC1 (clones) exonerate: EST2genes Marker_Feature (PCR primers) MMC2 (primers) e-PCR assess significance? Misc_Feature (REPORTER) collapse ESTs into clones Xref Xref: criteria? % alignment overlap w. exon boundaries ContigView display all features in ‘probes’ track FeatureView: positions in genome GeneView display reporters (& experiments?) in geneview FeatureView: positions in genome Links to genes Links to experiments 2 - reporter2gene

21. VectorBase MMC1 locations

22. VectorBase MMC1 locations table

23. VectorBase MMC1 genes

24. VectorBase MMC1 genes table

25. VectorBase MMC2 locations

26. VectorBase MMC2 genes

27. VectorBase MMC2 table

28. VectorBase MMC DAS tracks http://base.vectorbase.org:8080/das

29. VectorBase MMC listings http://base.vectorbase.org:8080/MMC1.jsp http://base.vectorbase.org:8080/MMC2.jsp

30. VectorBase fin Thanks… – Bob, George, Fotis – Dan, Karyn, Martin @ EBI – Ian Sealy @ Sanger – Informatics support @ Sanger

31. VectorBase EST quality TOTAL: 19280 OK: 17186(89.14%) POOR: 2094 (10.86%) – repetitive:2094 – short:36 – avg length (bp):576.39 – avg repeat %: 1.05%

32. VectorBase general runnable e! DB runnableDB runnable Exonerate BLAT ePCR DB record >> perl object perl object >> DB record process object run executable get object from db

33. VectorBase MMC1 runnable e! DB runnableDB runnable Exonerate BLAT ePCR DB record >> dna align object dna align object >> DB record MMC1_xrefreporter XREF

34. VectorBase MMC2 runnable e! DB runnableDB runnable Exonerate BLAT ePCR DB record >> marker object marker object >> DB record MMC2_xrefreporter XREF