1. Emelia Sodders Berglund Lab 17 August 2012 MBNL1 interaction with modified CUG/CCUG repeat RNA

2. Myotonic Dystrophy Inherited type of muscular dystrophy Disease Symptoms: Muscular Weakness Myotonia Insulin insensitivity Cardiac arrhythmia Cataracts

3. Myotonic Dystrophy is a disease caused by expanded repeats ZNF9 (CCTG)n DM1: expansion of CTG repeats in the 3’ UTR of the DMPK gene Unaffected: N=5-50 CUG repeats Affected: n= 50-4000 CUG repeats DM2: expansion of CCTG repeats in the first intron of ZNF9 gene Unaffected: n=7-24 CCUG repeats Affected: n=75-11,000 CCUG repeats DMPK (CTG) n

4. MBNL1 sequestered in CUG/CCUG repeat RNA MBNL1: Muscleblind- like 1 proteins MBNL1 proteins are expressed at high levels in skeletal muscles and is known to be directly involved in causing Myotonic Dystrophy ZNF9 UC U G CCUGCCUGCCUGCCUGCCUGCCUG GUCCGUCCGUCCGUCCGUCCGUCC

5. MBNL1 interacts with the Watson- Crick side of YGCY motifs MBNL1 binds a YGCY consensus sequence This crystal structure shows it interacts with the Watson- Crick side of the YGCY motifs This structure contains minimal RNA binding domain and a short RNA oligonucleotide 5’ 3’ 5’ 3’ C G U U C C G GU Teplova et al 2008 5’ 3’

6. Model: MBNL1 binds relaxed CUG/CCUG repeats between RNA strands CUG/ CCUG repeats “breathe” relaxing their helices MBNL proteins bound to CUG/CCUG repeats can no longer access their target transcripts

7. Goal: To determine how the addition of structure stabilizing modifications affects MBNL1’s ability to bind CUG/CCUG repeat RNA Determine if MBNL1 has a reduced affinity for RNA with a stabilized structure Use a modified base to stabilize the secondary structure

8. Pseudouridine () stabilizes RNA secondary structure Pseudouridine is an isomerization product of uridine The extra NH group adds another H-bond donor Pseudouridine has been shown to stabilize secondary structure of RNA

9. Hypothesis: Addition of Pseudouridine will inhibit MBNL1 binding Reduce MBNL1’s ability to bind CCUG repeat RNA ZNF9 U G C C U G ᴪ C U G C C ᴪ G G ᴪ C C G U C ᴪ G U C C UC

10. In vitro Transcription can be used to generate RNA with modifications Transcription: process that involves the transcribing of genetic information from DNA to RNA T7 Transcription is the simple in vitro assay that I can use to incorporate Pseudouridine into CUG/CCUG repeats 3’ 5’5’ Noncoding strand (Template) T7 RNA Polymerase

11. T7 Transcription Reaction To start, we tried out transcribing an RNA with 6 CUG repeats and an RNA with 6 CCUG repeats CCUG6+ CCUG6- CUG6+ CUG6-

12. Changing the Conditions Different CCUG6 template and coding strand Nucleotide Concentration Varying template concentration/ different amounts of template in reaction Time length Varying Magnesium buffer

13. Different CCUG6 Template and Coding Strand Expected size: CCUG: 46 nucleotides CUG: 58 nucleotides Changing the template strand to optimize the reaction made it successful CUG6+ CUG6- CCUG6+ CCUG6- 100 bp

14. Radioactive CTP We did the identical reaction with radioactive nucleotides so the RNA products could be used in Gel shift experiments We did not run a radioactive ladder so we did not know the size of the bands CUG6- CUG6+ CCUG6- CCUG6+

15. Gel Shift Assay CCUG6CUG6 CUG4 I wanted to test MBNL1’s binding ability to the RNA I transcribed using a gel shift assay

16. Changing the Nucleotide conditions I used CUG4 instead of a ladder to make sure CCUG6 was migrating more slowly than CUG4 Changed the nucleotide concentrations from 0.5 mM to 0.1 mM CUG6- CUG6+ CCUG6- CCUG6+ CUG4

17. T7 CCUG6/CUG6 Transcription Reaction with Radioactive CTP and Pseudouridine I did the same T7 transcription reaction using Pseudouridine modified nucleotides CUG6+ CUG6- CCUG6- CCUG6+ 0% ᴪ 50% ᴪ 100% ᴪ

18. Summary/Conclusions Spent a lot of time and effort optimizing and transcribing CCUG repeats with Pseudouridine Goal: To determine how the addition of structure stabilizing modifications affects MBNL1’s ability to bind CCUG/CUG repeat RNA

19. Future Directions Gel Shift Assay with modified CCUG6 and CUG6 Repeat RNA to test MBNL1’s binding ability Determine the stability of repeats with and without pseudouridine using thermal melt assays

20. Acknowledgments Andy Berglund (Principle Investigator) Elaine DeLorimier (Mentor) Leslie Coonrod Stacey Wagner Dylan Farnsworth Julia Oddo Ruth Siboni Rodger Woelker Dave Youngentob