1. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Jemboss – a Graphical User Interface for the EMBOSS suite of programs

2. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk EMBOSS Command line based Options not obvious – must be remembered Jemboss Point and Click interface Portable interface – use with PCs, Mac OSX, UNIX Options listed in program form

3. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk embl:m93650 seqret -sequence em:m93650 -sbegin1 0 -send1 0 -nofirstonly -auto >HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc Remote server Local computer Databases EMBL accession =m93650

4. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk EMBOSS applications Job manager Mode Local file manager Tool bar

5. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Local file manager

6. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk home directory preferred directory

7. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

8. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk confirm directory path

9. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk new default directory

10. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk EMBOSS applications

11. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Select appropriate program from the category menus

12. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Selection from alphabetical list, using the “Go To” field programs are highlighted based unambiguous letters

13. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk input possibilities calculates nature of sequence and default settings

14. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Database entry in format database:entry

15. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk drag and drop the file into the sequence field

16. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk File (path) now specified

17. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk cut and paste a sequence from elsewhere

18. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Mode

19. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Interactive mode – Jemboss is suspended until program has been completed

20. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk results tab

21. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk input files tab

22. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk command line tab

23. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

24. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Saved file. All graphics files MUST be saved with a.png extension

25. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Job manager Mode

26. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

27. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk job statusjob is processed in the background

28. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk job status

29. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

30. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Results can be saved in exactly the same manner as before. Note: no command line tab

31. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Tool bar

32. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

33. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk select an application input file and command line information is displayed Notes on the experiment or analysis may be saved to the server along with the results

34. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

35. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

36. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

37. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Disable parameters by shading (selected) or removing them (deselected) Auto-refresh. More often for slower connection, less often for a faster connection. Alteration of default home directory path setting

38. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

39. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk The server settings and environment information should be the same

40. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

41. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk Default output for Jemboss is fasta format, so this may have to be altered This third party software has also been incorporated into Jemboss

42. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

43. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk This is the beginnings of a project management system.

44. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk

45. UK MRC Human Genome Mapping Project Resource Centre http://www.hgmp.mrc.ac.uk The version should always be reported if there are any problems with the program brief user guide