1. ©2001 Timothy G. Standish Matthew 13:17 17For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them; and to hear those things which ye hear, and have not heard them.

2. ©2001 Timothy G. Standish DNA Sequencing Timothy G. Standish, Ph. D.

3. ©2001 Timothy G. Standish Sequenced Genomes Over the past three years large scale sequencing of eukaryotic genomes has become a reality Currently the sequencing of at least 5 multi-celled eukaryotic genomes has been completed: 1998 Caenorhabditis elegans - 8 x 10 7 bp - A nematode worm 2000 Homo sapiens - 3 x 10 9 bp - Humans 2000 Arabidopsis thaliana - 1.15 x 10 8 - A plant related to mustard 2000 Drosophila melanogaster - 1.65 x 10 8 bp - Fruit flies 2002 Anopheles gambiae – 2.78 x 10 8 bp mosquito vector of malaria

4. ©2001 Timothy G. Standish New Technology Rapid sequencing of large complex genomes has been made possible by: Foundational work done over many years and… Dramatic improvement in DNA sequencing technology over the past few years In this presentation we will look at both the basic principles of DNA sequencing and how techniques have been refined to yield the dramatic results we now see

5. ©2001 Timothy G. Standish A Sequencing Timeline 1977 Sanger and Maxam-Gilbert sequencing techniques developed 1980 M13 vector developed for cloning, many refinements and application of computer technology 1990 Improved sequencing enzymes, fluorescent dyes developed, robotics used for high throughput 1997 Sacromycetes Cerevisiae genome sequenced 1999 Caenorhabdits elegans Human chromosome 22 and about 20 bacterial genomes 2000 Drosophila melanogaster, Homo sapiens, Arabidopsis thaliana = 2,000 bp 20 X 100 bp Total/weekSamples/person/weekAverage read length = 18,000 bp 60 X 300 bp = 90,000 bp 180 X 500 bp = 325,000 bp 500 X 650 bp =3,000,000bp 5000 X 600 bp = 200 bp 4 X 50 bp

6. ©2001 Timothy G. Standish Basic Principles All current practical DNA sequencing techniques can be divided into four major steps: 1. Labeling of DNA so that small quantities can be easily detected, traditionally done by labeling with either P 32 or S 35 2. Generation of fragments for which the specific bases at the 3’ end are known 3. Separation of fragments using gel electrophoresis sensitive ennough to resolve differenced in size of one nucleotide 4. Fragment detection

7. ©2001 Timothy G. StandishOutline In this presentation we will look at: 1. The Maxam-Gilbert and Sanger methods of DNA fragment generation 2. Then methods for separation of fragments 3. And finally examine how these techniques have been refined and automated to allow for rapid cheap sequencing of large quantities of DNA

8. ©2001 Timothy G. Standish The Maxam-Gilbert Chemical Method Three major steps: 1. DNA to be sequenced is typically labeled at the 5’ end using P 32 2. Fragments are generated using chemicals that break DNA at specific bases 3. These fragments are then separated and detected using autoradiography Polyacylamide Gel Electrophoresis is typically used to separate fragments on the basis of single nucleotide differences

9. ©2001 Timothy G. Standish 2 Fragment Generation A number of chemicals will specifically modify the bases in DNA Modified bases can then be removed from the deoxyribose sugar to which they are attached on the sugar-phosphate DNA backbone Piperidine, a volatile secondary amine, is used to cleave the sugar-phosphate back bone of DNA at sites where bases were modified

10. ©2001 Timothy G. Standish Cleavage at Specific Bases Typically 5 reactions are run: 1.Dimethylsulfate at pH 8.0 results in modification of guanine (G) 2.Piperidine formate at pH 2.0 breaks glycosidic bonds between deoxyribose and both purines, guanine (G) and adenine (A), by protination of nitrogen atoms 3.Hydrazine (rocket fuel!) opens pyrimidine rings on both pyrimidines, cytosine (C) and thymine (T) 4.Hydrazine in the presence of 1.5 M NaCl only reacts with C 5.1.2 N NaOH at 90 o C strongly cleaves at A and may also weakly cleave at C

11. ©2001 Timothy G. Standish Cleavage at Specific Bases The trick in chemical sequencing is to not allow the reactions to go to completion Partial reactions run using the following conditions will result in a series of labeled DNA fragments whose final base is known: Dimethylsulfate at pH 8.0 -----------> G Piperidine formate at pH 2.0 -------> G and A Hydrazine ------------------------------> C and T Hydrazine in 1.5 M NaCl -----------> C 1.2 N NaOH at 90 o C -----------------> A and some C

12. ©2001 Timothy G. Standish Partial Reactions: Dimethylsulphate pH 8.0 P 32 5’ * NNGACGTACTTA 3’

13. ©2001 Timothy G. Standish Partial Reactions: Dimethylsulphate pH 8.0 5’ * NNGACGTACTTA 3’ Modification of some, but not all, of the G bases as the reaction is not allowed to go to completion

14. ©2001 Timothy G. Standish Partial Reactions: Dimethylsulphate pH 8.0 5’ TACTTA 3’ 5’ ACGTACTTA 3’ 5’ TACTTA 3’ 5’ ACGTACTTA 3’ 5’ TACTTA 3’ 5’ * NNGAC 3’ 5’ * NN 3’ 5’ * NNGAC 3’ Following breaking of the DNA strand at positions where G was chemically modified, two sets of fragments result: 1) A labeled set all ending where a G once was and 2) An unlabeled set which cannot be detected using autoradiography Unlabeled fragments undetectable using autoradiography Labeled fragments all of which represent a place where G used to be

15. ©2001 Timothy G. Standish Partial Reactions: Hydrazine 5’ * NNGACGTACTTA 3’ Some, but not all, C and T bases are modified as the reaction is not allowed to go to completion

16. ©2001 Timothy G. Standish Partial Reactions: Hydrazine 5’ * A 3’ 5’ GTACTTA 3’ 5’ * A 3’ 5’ * TA 3’ 5’ G 3’ 5’ ACTTA 3’ 5’ ACTTA 3’ 5’ * NNGACGTAC 3’ 5’ * NNGA 3’ 5’ * NNGACGTACT 3’ 5’ * NNGACGTAC 3’ 5’ * NNGA 3’ 5’ * NNGACG 3’ Following breaking of the DNA strand at positions where C or T was chemically modified, two sets of fragments result: 1) A labeled set all ending where a C or T once was and 2) An unlabeled set which cannot be detected using autoradiography Unlabeled fragments Labeled T C set

17. ©2001 Timothy G. Standish Disadvantages Toxic chemicals Large amounts of radioactivity Sometimes ambiguous and frequently ugly sequencing gels Tricky to read autorads Lack of automated methods

18. ©2001 Timothy G. Standish Sanger Sequencing The Sanger sequencing method takes advantage of the way that normal DNA replication occurs For DNA to be extended using normal DNA polymerases, a hydroxyl group must be present at the 3’ carbon on deoxyribose Fragments are generated by spiking reactions with small quantities 2’ 3’ dideoxy nucleotides which terminate polymerization whenever they are incorporated into DNA Polymerases used must lack 3’ to 5’ exonuclease proof reading activity for this method to work

19. ©2001 Timothy G. Standish H P O OH HO O O CH 2 NH 2 N N N N Sugar Base Phosphate 3’ 5’ 2’ 1’4’Dideoxynucleotides DNA Sequencing using the Sanger method involves the use of 2’3’-dideoxynucleotide triphosphates in addition to regular 2’-deoxynucleotide triphosphates Because 2’3’-dideoxynucleotide triphosphates lack a 3’ hydroxyl group, and DNA polymerization occurs only in the 3’ direction, once 2’3’-dideoxynucleotide triphosphates are incorporated, primer extension stops H 2’3’-dideoxynucleotide monophosphate 2’-dideoxynucleotide monophosphate

20. SUGAR-PHOSPHATE BACKBONE H P O HO O O CH 2 HOH P O O HO O O CH 2 H P O OH HO O O CH 2 NH 2 N N N N O O N NH N N N O NH 2 N B A S E S 2’3’ dideoxy- nucleotides Terminate DNA Replicaton O H P O HO O O CH 2 HO O H2NH2N N HN N N H HOH P O O O CH 2 CH 3 O O HN N OH H P HO O O CH 2 H O N O H2NH2N N H2OH2O 2’3’dideoxynucleotide

21. ©2001 Timothy G. Standish Making DNA Fragments In Sanger DNA sequencing reactions all the basic components needed to replicate DNA are used 4 reactions are set up, each containing: –DNA Polymerase –Primer –Template to be sequenced –dNTPs –A small amount of one ddNTP ddATP, ddCTP, ddGTP, ddTTP As incorporation of ddNTPs terminates DNA replication, a series of fragments is produced all terminating with the ddNTP that was added to each reaction

22. ©2001 Timothy G. Standish DNA Sequencing Plasmid (or phage) with cloned DNA fragment Primer Binding sites Cloned fragment Primer

23. ©2001 Timothy G. Standish The ddATP Reaction 5’TTATCG 3’AATAGCATGGTACTGATCTTACGCTAT5’ 5’TTATCGTACCATGACTAGATGCGA 5’TTATCGTACCA 5’TTATCGTACCATGACTA 5’TTATCGTA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGATGCGATA 5’TTATCGTACCATGACTAGA Pol. 5’TTATCGTA Let me Through! Pol. 5’TTATCGTACCATGA Oh come on! Pol. 5’TTATCGTACCATGACTAGA Not Again! Pol. 5’TTATCGTACCATGACTAGATGCGATA Agggg….

24. ©2001 Timothy G. Standish Separation of DNA Fragments All current practical sequencing methods rely on separation of DNA fragments in such a way that differences in length of a single base can be resolved This is typically done using polyacrylamide gel electrophoresis

25. ©2001 Timothy G. Standish Acrylamide Polyacrylamide Gels Polyacrilamide is a polymer made of acrylamide (C 3 H 5 NO) and bis-acrilamide (N,N’-methylene- bis-acrylamide C 7 H 10 N 2 O 2 ) O CH CH 2 NH 2 C O CHCH 2 NH 2 C CH 2 bis-Acrylamide O CHCH 2 NH 2 C Acrylamide

26. ©2001 Timothy G. Standish Polyacrylamide Gels O CHCH 2 NH 2 C O CHCH 2 NH 2 C SO 4 -. Acrylamide polymerizes in the presence of free radicals typically supplied by ammonium persulfate

27. ©2001 Timothy G. Standish Polyacrylamide Gels l Acrylamide polymerizes in the presence of free radicals typically supplied by ammonium persulfate SO 4 -. O CHCH 2 NH 2 C O CHCH 2 NH 2 C O CHCH 2 C O CHCH 2 NH 2 C TMED (N,N,N’,N’-tetramethylethylenediamine) serves as a catalyst in the reaction

28. ©2001 Timothy G. Standish Polyacrylamide Gels bis-Acrylamide polymerizes along with acrylamide forming cross-links between acrylamide chains O CHCH 2 NH 2 C O CHCH 2 NH 2 C O CHCH 2 NH 2 C O CHCH 2 C O CHCH 2 NH 2 C O CHCH 2 NH 2 C bis-Acrylamide O CH CH 2 NH 2 C O CHCH 2 NH 2 C CH 2

29. ©2001 Timothy G. Standish Polyacrylamide Gels bis-Acrylamide polymerizes along with acrylamide forming cross-links between acrylamide chains

30. ©2001 Timothy G. Standish Polyacrylamide Gels Pore size in gels can be varied by varying the ratio of acrylamide to bis-acrylamide Lots of bis-acrylamide Little bis-acrylamide DNA sequencing separations typically use a 19:1 acrylamide to bis ratio

31. ©2001 Timothy G. Standish Denaturation of DNA For gel electorphoresis to accurately separate on the basis of size and not shape or other considerations it is important that the DNA be denatured This is typically achieved by using a high urea concentration (8 M) in the gel Double stranded DNA Denatured Single Stranded DNA 8 M Urea Self annealing DNA 8 M Urea Denatured Single Stranded DNA

32. ©2001 Timothy G. Standish 5’ GACGTACTTA 3’ G G+A T+C C A>C Separation of Fragments: Maxam-Gilbert 1.2 N NaOH at 90 o C A>C Hydrazine T+C Piperidine formate pH 2 G+A Dimethyl sulfate pH 8 G Hydrazine in 1.5 M NaCl C X X X X X X 5’ to 3’

33. ©2001 Timothy G. Standish Separation of Sanger Fragments Products from 4 reactions each containing a small amount of a dideoxynucleotide are loaded onto a gel Because polymerization goes 5’ to 3’ shortest fragments are 5’ compared to longer fragments which are in the 3’ direction ddTTPddCTPddGTPddATP Read 5’ to 3’ from bottom to top

34. ©2001 Timothy G. Standish To read the autorad it is important to start at the bottom and work up so that it is read in the 5’ to 3’ direction DNA Sequencing What A Sequencing Autorad Actually Looks Like A C G T 5’ CTAGAGGATCCCCGGGTACCGAGCT... 3’

35. ©2001 Timothy G. Standish Sequencing Method Refinements Because of difficulties intrinsic to the Maxam- Gilbert chemical sequencing strategy, efforts at improvement have been concentrated on the Sanger method Major improvements in the following areas have been achieved Labeling and detection Fragment separation DNA Polymerases used in sequencing and resulting strategies for generation of fragments Automation

36. ©2001 Timothy G. Standish Pros and Cons of the Sanger Method It is more amenable to automation than Maxam- Gilbert Fewer dangerous chemicals are used, but acrylamide and P 32 or S 35 are still a problem Gels or autorads are generally cleaner looking and the reading of bases is a lot easier than Maxam- Gilbert data The bottom line: Without improvements in automation, detection and separation technologies Sanger sequencing is still very labor intensive

37. ©2001 Timothy G. Standish Labeling and Detection Labeling using radioactive isotopes is difficult, dangerous and expensive Using biotin labeled primers has allowed conjugation of enzymes to fragments and their subsequent detection using substrates that change color in the presence of the enzyme This technique is clumsy, expensive, time consuming and unreliable It also may require transfer of fragments to membranes thus increasing labor and generally has not caught on

38. ©2001 Timothy G. Standish Labeling and Detection Another approach has involved development of very sensitive silver staining technologies I have tried this one, it is miserable and unreliable Read length on gels is typically short and creation of a permanent copy of the gel requires expensive additional equipment and supplies It may not involve isotopes, but it is such a hassle and the data is of such low quality that it is not worth the effort

39. ©2001 Timothy G. Standish Labeling and Detection The most significant advance in labeling has been the production of electrophoretically neutral dyes that fluoresce at specific wavelengths when excited by laser produced light over a very narrow range of wavelengths These dyes, when attached to primers allow detection down to 15 attomoles (10 -18 ) That’s less than 10 7 molecules!

40. ©2001 Timothy G. Standish The Li-Cor System l Fluorescence of dyes attached to DNA fragments are detected as they pass the lasers and detectors l Data in digital form is fed directly into a computer system where automated base calling is done l A graphic representation of the data resembles a traditional autorad with bands appearing in 4 lanes l Li-Cor of Lincoln, Nebraska was one of the first to implement fluorescent dyes as part of an automated sequencing system l The Li-Cor system uses infrared lasers scanning a fixed line toward the bottom of an acrylamide slab gel

41. ©2001 Timothy G. Standish Dye labeled fragments Polyacrylamide gel The Li-Cor System A T G C Detector CCD Zappo Laser …..…..

42. ©2001 Timothy G. Standish Pros and Cons The Li-Cor systems major advantage is the lengths of its DNA reads –Because all fragments travel through the entire gel, resolution is sufficient to read over 1,000 bases in a single run with over 99 % accuracy –This is better than just about any single run manual sequencing method Elimination of manual reading of autorads also eliminates human error and removes a labor intensive step P 32 or S 35 not used - another major advantage Tricky acrylamide gels still must be cast and loaded manually

43. ©2001 Timothy G. Standish Applied Biosystems Applied Biosystems (ABI) has developed fluorescent dye systems further and improved methods for loading and electrophoresis Four dyes each of which fluoresce at a different wavelength, but having about the same impact on electrophoritic mobility can be used to label either primers or the nucleotides that terminate a reaction If terminator dyes are used, the entire sequencing reaction is reduced to one tube from 4 in conventional Sanger sequencing Instead of polyacrylamide slab gels, a single capillary can be used with a liquid polymer that is replaced after each individual run

44. ©2001 Timothy G. Standish 3’AATAGCATAACGTTAACGTTACGCTAT5’ Pol. Oh come on! 5’TTATCGTACCAC Pol. 5’TTATCGTACCATAATT Not Again! Pol. Agggg…. 5’TTATCGTACCATAATTGCA Replication Using Dye Terminators 5’TTATCG 5’TTATCGTATTGCAATTGCA 5’TTATCGTATTGCAATT 5’TTATCGTA 5’TTATCGTATTGCAAT 5’TTATCGTATTGCAATTG 5’TTATCGTATTGCA A 5’TTATCGTATTGCAATTGC 5’TTATCGTATTGC A 5’TTATCGTAT 5’TTATCGTATTG 5’TTATCGTATT 5’TTATCGTATTGC Pol. 5’TTATCGTA Let me Through! As the base at the end of each fragment is clearly marked with a unique fluorescent dye, the entire reaction can be done in a single tube

45. ©2001 Timothy G. Standish …..….. Heat plate Liquid polymer ATTGC A ABI Prism 310 System Zappo Laser Beam splitter Detectors - + Window Sequencing reaction Capillary

46. ©2001 Timothy G. Standish The State of the Art The ABI Prism 310 (1 capillary), 3100 (16 capillaries) and 3700 (96 capillaries) represent the current state of the art in automated sequencing machines A single ABI Prism 377 slab gel sequencer can run 115,000 bases per day! The 3100 can run up to 184,000 bases per day The 3700 can run up to 1,104,000 bases per day Large sequencing facilities, like Celera, have factories full of these machines which can run 24 hours a day with very little down time for routine maintenance

47. ©2001 Timothy G. Standish The State of the Art ABI Prism 3700

48. ©2001 Timothy G. Standish