1. 46 th Interscience Conference on Antimicrobial Agents and Chemotherapy September 27 - 30, 2006 San Francisco, California Paper # H-1670 Resistance Mechanisms of HIV-1 Reverse Transcriptase Mutants K65R, M184V, and K65R+M184V to NRTIs JK Ly, NA Margot, HL MacArthur, M Hung, MD Miller, KL White Gilead Sciences Inc., Foster City, CA

2. NtRTI and NRTI Resistance Mutation Background 8 currently approved NtRTI and NRTIs: –TDF, ddI, ABC, FTC, 3TC, ddC, AZT, d4T K65R: –Selected by TDF, ABC, ddI, and occasionally d4T –Observed in 2-5% of antiretroviral-experienced patients M184V: –Selected by FTC, 3TC, ABC –Observed in >50% of antiretroviral-experienced patients K65R+M184V: –Selected by TDF/FTC, ABC, other drug combinations –50% of patients with K65R also have M184V

3. Study Objective To measure the biochemical resistance mechanisms for K65R, M184V, and K65R+M184V mutant RT and determine their contributions to resistance. N(t)RTI Susceptibility Binding or IncorporationExcision = + Steady State K i / K m Excision Rate

4. Susceptibility of Mutant Viruses to N(t)RTIs a a. PhenoSense Assay (Monogram Biosciences). b. Mean fold change for K65R alone ( n > 110); M184V/I alone (n > 1930); K65R+M184V/I (n = 70). — Yellow bars represent lower clinical cut-offs.

5. Fold increase in K i / K m compared to wild-type a K65RM184VK65R+M184V TFV-DP7.81.15.6 ddATP6.81.612.8 FTC-TP3.9>15 3TC-TP2.1>10 CBV-TP4.83.111.6 d4T-TP5.70.84.8 AZT-TP4.91.96.1 Altered Binding or Incorporation of N(t)RTIs a. Mean fold increase were determined from 3 or more independent experiments.

6. Fold increase in K i / K m compared to wild-type a K65RM184VK65R+M184V TFV-DP7.81.15.6 ddATP6.81.612.8 FTC-TP3.9>15 3TC-TP2.1>10 CBV-TP4.83.111.6 d4T-TP5.70.84.8 AZT-TP4.91.96.1 Altered Binding or Incorporation of N(t)RTIs a. Mean fold increase were determined from 3 or more independent experiments.

7. Excision Assay Methodology HIV-1 RT Ŧ dNTP(Next nt) Rescue of polymerization assay: − Primer-NRTI :: Template − HIV-1 RT (excess) − Physiological [ATP] and [dNTPs] − Time course, RT inactivation − dNTP + Klenow elongation Factors affecting excision: − RT mutations − N(t)RTI translocation − Next nucleotide inhibition − Primer/template sequence context *-5’CTACTAGTTTTCTCCATCTAGACGATACCAGA 3’GATGATCAAAAGAGGTAGATCTGCTATGGTCTAACTTCTGGAGTCGTGAG ATP ATP-Ŧ

8. Altered Excision of N(t)RTIs (ATP-mediated) K65R and K65R+M184V mutants showed significantly reduced removal of TFV and AZT mediated by ATP. For all other NRTIs tested, ATP-mediated excision was minimal by WT and mutants. TFV dATP (  M) 0.11101001000 Primer Rescued (%) 2 4 6 8 10 12 14 WT K65R M184V K65R+M184V AZT 0.11101001000 2 4 6 8 10 12 14 Primer Rescued (%) dATP (  M)

9. Altered Excision of N(t)RTIs (PP i -mediated) 110100 20 40 60 80 100 TFV dATP (  M) Primer Rescued (%) WT K65R M184V K65R+M184V 110100 10 20 30 40 AZT Primer Rescued (%) dATP (  M) K65R and K65R+M184V mutants showed reduced removal of TFV and AZT by pyrophosphate. M184V showed reduced excision of AZT.

10. Conclusions In cells, both mechanisms of resistance—binding or incorporation (discrimination) and excision—may contribute to altered drug susceptibility K65R shows increased drug discrimination (increased K i /K m ) for all N(t)RTIs –Counteracted by decreased excision for most N(t)RTIs, resulting in full susceptibility to AZT M184V substrate discrimination correlates with N(t)RTI susceptibility –For AZT, decreased excision may also contribute to sensitization K65R+M184V results in additive resistance for ddI and ABC at the level of discrimination, but increased sensitivity relative to K65R for TDF, d4T and AZT –Sensitization to AZT may be due to decreased excision –Sensitization to d4T and TDF is likely at the level of substrate discrimination

11. Acknowledgements Clinical Virology, Foster City, CA Kirsten White Nicolas Margot Damian McColl Rebecca Ledford Michael Miller Clinical Virology, Durham, NC Joy Feng Jenny Svarovskaia Josh Waters Katyna Borroto-Esoda Biology Holly MacArthur Magdeleine Hung Ruth Wang Martin McDermott Manuel Tsiang Computational Chemistry James Chen S. Swaminathan